نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانش آموخته گروه محیط زیست، دانشگاه تربیت مدرس، دانشکده منابع طبیعی و علوم دریایی،

2 استادیار گروه محیط زیست، دانشگاه تربیت مدرس، دانشکده منابع طبیعی و علوم دریایی

3 دانشیار گروه زیست شناسی، دانشکده علوم، دانشگاه فردوسی مشهد

چکیده

برخی از گونه‌ها به صورت نادر تغییرات درون گونه‌ای تغییرات ژنتیکی و مورفولوژیکی بالایی را از خود نشان می‌دهند. دم‌سرخ معمولی (Common Redstart) از پرندگانی است که در ناحیه جغرافیایی پراکنش خود دارای تغییرات درون گونه‌ای بالاتر از حد آستانه بوده برای هر دو زیر گونه خود می‌باشد. وجود دو دودمان متفاوت از نظر ژن COXI قبلا رویت شده بود. هدف از این مطالعه، بررسی تغییرات درون گونه‌ای دم‌سرخ معمولی نسبت به تغییرات فاصله جغرافیایی و اثر آن در میزان واگرایی درون گونه‌ای، شیب ژنتیکی و وضعیت فیلوجغرافیایی آن بود. نمونه‌برداری در بهار سال‌های 93 و 94 از زیستگاه جوجه‌آوری صورت گرفت و توالی‌های حاصل از PCR باتفاق نمونه‌های بانک ژن تحلیل شد . نتایج درخت Baysian، دو کلاد اصلی جدا شده با بوت استرپ 100 را برای ژن COXI تائید کرد. شبکه‌های هاپلوتایپی، دو کلاد تشکیل شده در درخت تبارشناسی را به صورت جدا از هم تایید کرد. اما هاپلوگروپ‌های مجزا بر اساس منطقه جغرافیایی درون شبکه هاپلوتایپی مشاهده نشد. در نمودار تغییرات جریان ژنی به فاصله جغرافیایی، اگرچه روند مثبت نمودار بیانگر کاهش درون آمیزی به ازای افزایش فاصله می‌باشد اما با توجه به ضریب رگرسیون03/0 R² =، فاصله جغرافیایی به عنوان یک متغیر مستقل بر روی فاصله ژنتیکی اثر معنی‌دار نداشته است(P>0.05) . همچنین تحلیل PCoA نشان می‌دهد که جمعیت‌های متعلق به ترکیه در عین حال که به لحاظ ژنتیکی به جمعیت‌های منطقه ایران و روسیه و چک نزدیکتر می‌باشد، از سایر جمعیت‌ها به صورت مجزا قرار گرفته است. حلقه‌گذاری می‌تواند در تائید برخی یافته‌ها راه‌گشا باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Interaspecies changes in common redstart (Phoenicurus phoenicurus) in distribution range from Iran to west Palearctic using COX1 biomarker

چکیده [English]

Some species exhibited a rare intraspecific genetic variation and high morphological changes. Common redstart (Common Redstart) is one of birds with an intraspecific variation above threshold for both subspecies in geographical area of distribution. Two different lineages of COXI gene were already visible. The aim of this study was to investigate intraspecific changes in redstart regarding geographical distance and the effect of divergence within species, genetic slope and phylogeography situation. In the spring of 2014 and 2015, samples were collected from breeding areas and PCR samples were analyzed with gene banks sequence together. Results of Baysian tree, confirmed two main isolated clades with Bootstrap 100 for COXI gene. Haplotype network approved the separated clades formed in phylogeny tree separately. But separated Haplogroup which observed within the network not supported based on geographic region of haplotypes. The graph of gene flow versus geographical distance, although a positive trend graph shows a decrease in violent exchange for increased distance, but according to the regression coefficient R² =0.30, geographical distance as an independent variable on the genetic distance effect had no significant (P > 0.05). Also, PCoA results show population of Turkey is closer to Iran, Czech and Russia, but separated from other population. Banding recovery need to solve some questions.

کلیدواژه‌ها [English]

  • intraspecific changes
  • common redstart
  • haplotype network
  • GD/GDD
  • PCoa

تغییرات درون‌گونه‌ای دم‌سرخ معمولی (Phoenicurus phoenicurus) در محدوده پراکنش آن از ایران تا غرب پالئارکتیک با استفاده از زیست‌نشانگر COI 

زهره نصیری1، سیدمحمود قاسمپوری1* و منصور علی‌آبادیان2 

1 نور، دانشگاه تربیت مدرس، دانشکده منابع طبیعی و علوم دریایی، گروه محیط‌زیست  

2مشهد، دانشگاه فردوسی، دانشکده علوم، گروه زیست‌شناسی

تاریخ دریافت: 20/4/95                تاریخ پذیرش: 15/9/95 

چکیده 

برخی از گونه‌ها به‌صورت نادر تغییرات درون‌گونه‌ای، تغییرات ژنتیکی و مورفولوژیکی بالایی را از خود نشان می‌دهند. دم‌سرخ معمولی (Common Redstart) از پرندگانی است که در ناحیه جغرافیایی پراکنش خود دارای تغییرات درون‌گونه‌ای بالاتر از حد آستانه برای هردو زیرگونه خود می­باشد. وجود دو دودمان متفاوت ازنظر ژن سیتوکروم اکسیداز سی زیر واحد یک (COI)قبلاً رویت شده بود. هدف از مطالعه حاضر، بررسی تغییرات درون‌گونه‌ای دم‌سرخ معمولی نسبت به تغییرات فاصله جغرافیایی و اثر آن در میزان واگرایی درون‌گونه‌ای، شیب ژنتیکی و وضعیت فیلوجغرافیایی آن می‌باشد. نمونه­برداری در بهار سال­های 93 و 94 از زیستگاه جوجه‌آوری صورت گرفت و توالی‌های حاصل از PCR باتفاق نمونه­های بانک ژن تحلیل شد. نتایج درخت Bayesian، دو کلاد اصلی جداشده با احتمال پسین 100% را برای ژن COIتائید کرد. شبکه­های هاپلوتایپی، دو کلاد تشکیل‌شده در درخت تبارشناسی را به‌صورت جدا از هم تایید کرد. اما هاپلوگروپ‌های مجزا براساس منطقه جغرافیایی درون شبکه هاپلوتایپی مشاهده نشد. در نمودار تغییرات جریان ژنی به فاصله جغرافیایی، اگرچه روند مثبت نمودار بیانگر کاهش درون آمیزی به ازای افزایش فاصله می‌باشد اما با توجه به ضریب رگرسیون 03/0R² =، فاصله جغرافیایی به‌عنوان یک متغیر مستقل بر روی فاصله ژنتیکی اثر معنی‌دار نداشته است (05/0P>) .همچنین تحلیل PCoA نشان می‌دهد که جمعیت‌های متعلق به ترکیه درعین‌حال که به لحاظ ژنتیکی به جمعیت‌های منطقه ایران و روسیه و چک نزدیکتر می‌باشد، از سایر جمعیت‌ها به‌صورت مجزا قرارگرفته است. حلقه­گذاری می­تواند در تائید برخی یافته­ها راه­گشا باشد.

واژه­های کلیدی: تغییرات درون‌گونه‌ای، دم‌سرخ معمولی، شبکه هاپلوتایپی، فاصله جغرافیایی به ژنتیکی، PCoA

* نویسنده مسئول، تلفن: 09111530332 ، پست الکترونیکی: ghasempm@modares.ac.ir  

مقدمه

 

گونه به‌عنوان واحد بنیادی در زیست‌شناسی تلقی می‌شود (21) و تعاریف متعددی ازجمله زیست‌شناختی، بوم‌شناختی، تکاملی و تبارشناختی برای آن مطرح شده است. به لحاظ زیست‌شناسی گونه به واسطه طبیعت ذاتی و معیارهایی همچون جدایی تولیدمثلی و نه شباهت‌های ظاهری قابل تشخیص است (14و 27). اما هریک از تعاریف گونه دارای نقایصی در توضیح حدود گونه‌ای می‌باشد که منجر به نیم‌قرن جنجال در تعاریف مربوط به طبقه‌بندی گونه، روش‌های استنتاج مرزها و تعداد گونه‌ها شده است (11). روش‌های تجربی زیادی در دو طبقه‌بندی اصلی یعنی روش‌های مبتنی بر درخت فیلوژنی و روش‌های غیردرختی، برای تعیین حدود گونه‌ای وجود دارد. در روش‌های مبتنی بر درخت، تعیین حدود گونه‌ای براساس ویژگی‌های مرتبط با توپولوژی درخت فیلوژنی (تک‌نیایی، تطابق با جغرافیا) می‌باشد و روش‌های غیردرختی نیز براساس استنتاج غیرمستقیم از وجود و عدم وجود جریان ژن تمرکز دارد (32).

اگرچه به‌طور معمول انتظار می‌رود افراد یک گونه از تغییرات ژنتیکی کمی برخوردار باشند اما برخی از گونه‌ها سطوح بالایی از تغییرات ژنتیکی و مورفولوژیکی را به‌صورت درون‌گونه‌ای از خود نشان می‌دهند. در حدود 30 سال پیش ریچارد لونتین به این نتیجه رسید که تنوع تغییرات درون‌گونه‌ای به‌شدت غیرطبیعی است و تائید کرد که رانش ژنتیکی و انتخاب طبیعی توضیحات احتمالی برای این حقیقت را فراهم می‌کند (26). به­دلیل نرخ تکاملی سریعتر تغییرات در ژنوم میتوکندریایی نسبت به ژنوم هسته‌ای، استفاده از آن به‌عنوان بیومارکر در نشان دادن تغییرات ژنتیکی درون‌گونه‌ای کاربرد یافته است (3). علاوه بر این، کاربرد بیوماکرهای ژنوم میتوکندریایی با توصیف الگوهای ساختار ژنتیکی درون‌گونه‌ای و آشکار کردن دودمان‌های واگرا، رویکرد نسبتاً کارآمدی را برای تشخیص گونه‌های جدید فراهم می‌کند (5، 9 و 12). واگرایی ژن COI در درون گونه‌ها بطور متوسط 20 مرتبه کوچکتر از بین گونه‌ها بوده و فاصله مشخصی بین واگرایی درون و بین‌گونه‌ای وجود دارد به همین دلیل مفهوم تغییرات درون‌گونه‌ای و مرز آن با تغییرات بین‌گونه‌ای به‌عنوان پایه و اساس استفاده از یک قطعه 628 نوکلئوتیدی از ژنوم میتوکندریایی یعنی COI در شناسایی گونه‌ها کاربرد پیداکرده است. این فاصله بارکد، حد آستانه (10 مرتبه بزرگتر از میانگین واگرایی درون گونه‌ای) را برای تعریف مرز بین‌گونه‌ای فراهم نموده است و کارائی این ژن در نشان دادن اختلاف بالا بین دو فاصله درون گونه‌ای و بین‌گونه‌ای با اولین مطالعات با بررسی 260 گونه جوجه‌آور در آمریکای شمالی تائید شد (17و 18). به همین ترتیب این ژن کارایی خود را در بازشناسی پراکنش گونه‌ها و الگوهای جغرافیای زیستی نشان داده است (8، 1و 2).

دم‌سرخ معمولی (Common Redstart) پرنده‌ای کوچک و مهاجر از راسته گنجشک‌سانان Passeriformes و خانواده مگس‌گیر‌ها Muscicapidae بانام علمی (Linnaeus 1758)  Phoenicurus  phoenicurus بوده که از دو زیرگونه اصلی با نام‌های  phoenicurus و samamisicus برخوردار است (13). درمجموع، دم‌سرخ معمولی در پالئارکتیک پراکنش وسیعی دارد و بیشترین جمعیت زادآور این‌گونه در اروپا زیست می‌کند (7). زیرگونه phoenicurus در اروپا (به‌غیراز جنوب شرقی آن)، شمال غربی آفریقا، شرق تا مرکز سیبری و شمال مغولستان، و به‌صورت غیر زادآور در آفریقا پراکنش دارد. زیرگونه samamisicus  در جنوب بالکان و یونان به سمت شرق ترکمنستان، جنوب ازبکستان، ایران و به‌صورت غیرزادآور در شمال شرقی آفریقا و شبه‌جزیره عربستان گسترده شده است. بارزترین وجه تمایز جنس نر این زیرگونه با زیرگونه اول، لکه سفیدروی بال بیان‌شده است (10). در ایران، پایین‌ترین حد حضور دم‌سرخ معمولی در دامنه‌های شمالی البرز و لکه کوچکی در جنوب کشور می‌باشد (7). 

مطالعات نشان می‌دهد که در دم‌سرخ معمولی دو دودمان متفاوت ازنظر ژن COI وجود دارد که میزان این واگرایی به‌اندازه 5 درصد  K2Pمی‌باشد. دم‌سرخ‌ها دارای تغییرات درون گونه‌ای بالاتر از حد آستانه در ناحیه جغرافیایی پراکنش خود می‌باشند که این تغییرات در هر دو زیرگونه قابل‌مشاهده است. از سال 2010 به بعد، تغییرات درون گونه‌ای بالا برای دم‌سرخ معمولی در ناحیه جغرافیایی پالئارکتیک گزارش‌شده است (22 و 19) که در آن به مواردی از قبیل شیب تغییرات ژنتیکی، میزان تمایز جمعیت‌ها در کشورهای مختلف اروپایی، ترکیه و ایران به‌اندازه کافی توجه نشده، لذا این مطالعه سعی دارد ضمن نشان دادن تفاوت دودمانی بین افراد این‌گونه، به فواصل کلادی و وضعیت شبکه‌های هاپلوتایپی اشاره داشته باشد. هدف از این مطالعه، بررسی تغییرات درون گونه‌ای دم‌سرخ معمولی در محدوده پراکنش این‌گونه نسبت به تغییرات فاصله جغرافیایی می‌باشد و اینکه فاصله جغرافیایی تا چه اندازه در واگرایی درون گونه‌ای دم‌سرخ، شیب ژنتیکی و وضعیت فیلوجغرافیایی گونه دخیل می‌باشد.

مواد و روشها

نمونه‌برداری: نمونه‌های به‌کاررفته در این مطالعه مربوط به چهار منطقه از شمال ایران با ارتفاع 1600 تا 2000 متری از سطح دریا است. الف) منطقه کدیر، منطقه‌ای کوهستانی در نیمرخ شمالی البرز مرکزی از توابع بخش کجور شهرستان نوشهر در استان مازندران با طول و عرض جغرافیایی51 درجه، 27 دقیقه و 56/29ثانیه شرقی و 36 درجه، 26 دقیقه و 81/50 ثانیه شمالی و ب) منطقه شهرستان خلخال در استان اردبیل با طول و عرض جغرافیایی 48 درجه، 31 دقیقه و 87/49 ثانیه شرقی و 37 درجه، 37 دقیقه و 43/25 ثانیه شمالی، که نمونه‌برداری از آن‌ها در طی سال‌های 94- 93 انجام گردید. همچنین داده‌های حاصل از نمونه‌برداری در سال‌های 89-87 از دو منطقه دیگر: ج) مازیچال شهرستان کلاردشت استان مازندارن با طول و عرض جغرافیایی 51 درجه، 3 دقیقه و 83/16 ثانیه شرقی و 36 درجه، 32 دقیقه و 23/0 ثانیه شمالی و د) منطقه جیکا استان گلستان با طول و عرض جغرافیایی54 درجه، 19 دقیقه و 16/33 ثانیه شرقی و36 درجه، 35 دقیقه و 50/35 ثانیه شمالی نیز به‌عنوان داده‌های تکمیلی برای ایران از بانک ژن دریافت و مورداستفاده قرار گرفت (شکل 1). درمجموع 16 عدد نمونه خون از سیاهرگ زیرین بال از دم‌سرخ‌های معمولی به دام افتاده در تور نامرئی در فصل زادآوری گونه (بهار) جمع‌آوری و در بافر کویین نگهداری شد. از 16 عدد نمونه جمع‌آوری‌شده از منطقه کدیر، 8 عدد آن متعلق به جنس نر بوده که 3 نر فاقد لکه سفید بالی (زیرگونه اول) و 5 نر دارای لکه سفید بالی (زیرگونه دوم) را در برمی‌گیرد، از مابقی نمونه‌ها 4 عدد مربوط به جنس ماده و 4 عدد دیگر نیز مربوط به نابالغین بود (شکل 2).

PCR و توالی‌یابی: استخراجDNA  از نمونه خون، توسط روش نمکی (Salt Method) طبق پروتکل صورت گرفت (6). قطعه ژن میتوکندریایی  COI توسط آغازگرهای عمومی با برنامه دمایی مورد نظر (جدول1) تکثیر شد. مقادیر مواد موردنیاز جهت واکنش چرخه پلی­مراز برای آغازگر اول،l µ 25-20 آب مقطر استریل تزریقاتی،l µ 75/0 آغازگرBirdF1،l µ5/0 از هر دو آغازگرBirdR1 وBirdR2 وl µ 3 از DNA استخراج‌شده می‌باشد. برای آغازگر دومl µ19 آب مقطر استریل تزریقاتی، l µ1 آغازگرAF،l µ1 آغازگرAR وl µ 4 ازDNA  استخراج‌شده موردنیاز می‌باشد که داخل و یال‌های PCR خشک آماده ریخته می‌شوند.  همچنین به ازای هر نمونه 25/0 آنزیم تک پلی‌مراز به‌صورت جداگانه اضافه می‌گردد. بعد از انجام فرآیند PCR در انتها نمونه‌ها جهت توالی‌یابی به شرکت ماکروژن کره ارسال گردید.

تجزیه‌وتحلیل داده‌ها: توالی‌ها توسط نرم‌افزار Bioedit (16) به‌صورت دستی مرتب‌سازی شده و مورد ویرایش قرارگرفت. در انتها توالی به طول 528 نوکلئوتید برای هر نمونه به دست آمد. در مرحله بعد برای اطمینان از عدم وجود کدون‌های متوقف کننده توالی‌ها در نرم‌افزار  MEGA6  (33) موردبررسی قرارگرفتند. تحلیل بیزین با استفاده از روش زنجیره مارکوف مونت‌کارلو (Markov Monte Carlo Chain) با نرم‌افزارMrBayes3.2.2  انجام شد (20) که در آن مگس‌گیر سینه‌سرخ  Ficedula parvaبه‌عنوان گروه بیرونی در نظر گرفته‌ شده است. فرایند زنجیره مارکوف مونت‌کارلو، باده میلیون تکرار با پیش‌فرض قبلی انتخاب درخت در هر 1000 نسل (نتیجه 000/100 درخت) اجرا گردید. این تحلیل با انتخاب یک درخت به طور تصادفی شروع می‌شود. 5000 درخت اول برای حفظ سطح اطمینان نادیده گرفته و مقدار احتمال اولیه برای سایر درخت‌های باقی‌مانده محاسبه می‌شود. ترسیم شبکه هاپلوتایپی برمبنای حداقل فاصله (Minimum Spanning) توسط نرم‌افزارPopART  (25) صورت گرفت.

 

جدول 1 - توالی پرایمرهای مورد استفاده برای ژن سیتوکروم اکسیداز سی زیر واحد یک (COI)

منابع 

دمای اتصال آغازگرها 

توالی پرایمرها(5′-3′) 

جایگاه 

(13)

94◦C

F:5'-TTCTCCAACCACAAAGACATTGGCAC-3'

R:5'-ACGTGGGACATAATTCCAAATCCT-3'

R:5'-ACTACATGTGAGATGATTCCGAATCCAG-3'

BirdF1BirdR1

BirdR2 

(28)

94◦C

F: 5'- AACCAACCACAAAGACATTGG -3'

R: 5'- CCATGTAGCCGAATGGTTCT-3' 

AF

AR 

 

شکل 1- تصویر منطقه موردمطالعه که مکان جوجه آوری دم‌سرخ‌های معمولی تابستان گذران می‌باشد

 

تحلیل فاصله ژنتیکی به فاصله جغرافیایی و تحلیل PCoA  برای داده‌های هاپلوئید توسط نرم‌افزار GenALEx6.5  انجام شد (29). اندازه‌گیری فاصله ژنتیکی بین جمعیت‌ها توسط آزمون AMOVA انجام شد که در آن 15 خ¦PT"> معادل باFST  در نظر گرفته می‌شود. در تحلیل فاصله ژنتیکی به فاصله جغرافیایی توسط Mantel test، داده‌ها با 999 بار برای تخمین احتمال بالای 95% ماتریس ضریب همبستگی جا‌به‌جا شد. ضریب همبستگی (r) بین اعداد 1- تا 1 در حال تغییر است. احتمال 05/0>P  نشان می‌دهد که ضریب همبستگی به طور معنی‌داری متفاوت از 0 می‌باشد. مقادیر r شدت همبستگی بین فاصله جغرافیایی و ژنتیکی را نشان می‌دهد. رولف در سال 1993 (31) نشان می‌دهد که برای 7/0>r (یا 7/0- برای همبستگی‌های منفی) همبستگی، حتی زمانی که معنی‌داری متفاوت از صفر باشد، ضعیف هستند. زمانی که پیوستگی معنی‌دار بین فاصله جغرافیایی و ژنتیکی یافت شد نمودارهای پراکندگی به دست آمده مورد تجزیه‌وتحلیل قرار می‌گیرند.

نتایج 

به‌منظور انجام تحلیل  Bayesianدر کنار استفاده از 34 نمونه حاصل از نمونه‌برداری‌های انجام‌شده در ایران، از 182 توالی ژن COI متعلق به شش منطقه دیگر (نروژ، ترکیه، چک، روسیه، صربستان، اسپانیا) نیز استفاده شد (جدول 2). در نهایت 216 توالی در ناحیه پراکنش دم‌سرخ معمولی با 528 جفت نوکلئوتید مورد تجزیه‌وتحلیل قرارگرفت. در درخت حاصل از تحلیل مذکور، دو کلاد اصلی برای ژن  COIدر دم‌سرخ‌های معمولی به دست آمد. این دو کلاد با احتمال پسین 100 از یکدیگر جدا شده و در کلاد A بخشی از نمونه‌های ایران، ترکیه و روسیه به‌صورت یک هاپلوگروپ با احتمال پسین مشابه از سایر نمونه‌ها مجزا گشته است (شکل 3).

 

 

 

 

 

شکل 2- تصاویر گرفته‌شده توسط نگارنده از جنس نر دو زیرگونه دم‌سرخ معمولی (تصاویر پایین) به همراه جنس ماده (بالا، راست) و نابالغ آن (بالا، چپ)

جدول2- توالی‌های COI مربوط به پراکنش دم‌سرخ معمولی به‌کاررفته در این تحقیق که از بانک ژن دریافت شده است

منطقه

کد

شماره

منطقه

کد

شماره

منطقه

کد

شماره

Norway

JX970736

107

Norway

JX970783

54

Norway

JX970835

1

Norway

JX970735

108

Norway

JX970782

55

Norway

JX970834

2

CzechRepublic

JX970734

109

Norway

JX970781

56

Czech Republic

JX970833

3

Turkey

JX970733

110

Norway

JX970780

57

Norway

JX970832

4

Spain

JX970732

111

Norway

JX970779

58

Norway

JX970829

5

Norway

JX970731

112

Czech Republic

JX970778

59

Russia

JX970828

6

Russia

JX970730

113

Norway

JX970777

60

Norway

JX970827

7

Norway

JX970729

114

Spain

JX970776

61

Norway

JX970826

8

Spain

JX970728

115

Norway

JX970775

62

Norway

JX970825

9

Norway

JX970727

116

Norway

JX970774

63

Norway

JX970824

10

Czech_Republic

JX970726

117

Russia

JX970773

64

Norway

JX970823

11

Norway

JX970725

118

Norway

JX970772

65

Norway

JX970821

12

Norway

JX970724

119

Russia

JX970771

66

Norway

JX970820

13

Norway

JX970723

120

Norway

JX970770

67

Norway

JX970819

14

Norway

JX970722

121

Norway

JX970769

68

Norway

JX970818

15

Norway

JX970721

122

Norway

JX970768

69

Iran

JX970633

16

Norway

JX970719

123

Serbia

JX970767

70

Norway

JX970817

17

Norway

JX970718

124

Norway

JX970765

71

Norway

JX970816

18

Serbia

JX970717

125

Norway

JX970764

72

Russia

JX970814

19

Norway

JX970716

126

Norway

JX970763

73

Norway

JX970813

20

CzechRepublic

JX970715

127

Czech Republic

JX970762

74

Norway

JX970812

21

Norway

JX970713

128

Russia

JX970761

75

Spain

JX970811

22

Norway

JX970712

129

Norway

JX970760

76

Norway

JX970810

23

CzechRepublic

JX970711

130

Norway

JX970759

77

Norway

JX970809

24

Norway

JX970710

131

Norway

JX970758

78

Norway

JX970808

25

Norway

JX970709

132

Turkey

JX970757

79

Norway

JX970807

26

CzechRepublic

JX970708

133

Norway

JX970756

80

Spain

JX970806

27

Russia

JX970707

134

Norway

JX970755

81

Czech Republic

JX970805

28

Norway

JX970706

135

Norway

JX970754

82

Norway

JX970802

29

CzechRepublic

JX970705

136

Norway

JX970753

83

Serbia

JX970801

30

Norway

JX970704

137

Norway

JX970752

84

Norway

JX970800

31

Norway

JX970701

138

Norway

JX970751

85

CzechRepublic

JX970799

32

Turkey

JX970700

139

Spain

JX970750

86

Norway

JX970797

33

CzechRepublic

JX970699

140

Czech Republic

JX970749

87

Norway

JX970796

34

Norway

JX970698

141

Norway

JX970748

88

Norway

JX970795

35

Spain

JX970697

142

Norway

JX970747

89

Norway

JX970794

36

Turkey

JX970696

143

Russia

JX970746

90

Norway

JX970792

37

Norway

JX970695

144

Norway

JX970745

91

Turkey

JX970791

38

Norway

JX970694

145

Norway

JX970744

92

Norway

JX970790

39

Norway

JX970693

146

Czech

JX970743

93

Russia

JX970789

40

Norway

JX970692

147

Norway

JX970742

94

Turkey

JX970788

41

Norway

JX970691

148

Serbia

JX970741

95

Norway

JX970787

42

Serbia

JX970689

149

Norway

JX970740

96

Norway

JX970786

43

Norway

JX970688

150

Norway

JX970738

97

Norway

JX970784

44

Norway

JX970667

151

Norway

JX970676

98

Russia

JX970686

45

Norway

JX970666

152

Russia

JX970675

99

Norway

JX970685

46

Turkey

JX970664

153

Norway

JX970674

100

Turkey

JX970684

47

Spain

JX970663

154

Norway

JX970673

101

Norway

JX970683

48

Norway

JX970662

155

Norway

JX970672

102

Norway

JX970682

49

Norway

JX970661

156

Norway

JX970671

103

Norway

JX970681

50

Norway

JX970659

157

Turkey

JX970670

104

Norway

JX970680

51

Norway

JX970658

158

Turkey

JX970669

105

Turkey

JX970679

52

Norway

JX970657

159

Norway

JX970668

106

Norway

JX970678

53

Iran

JX970804

188

Czech_Republic

JX970642

174

Czech_Republic

JX970656

160

Iran

JX970803

189

Norway

JX970640

175

Norway

JX970655

161

Iran

JX970798

190

Russia

JX970639

176

Norway

JX970654

162

Iran

JX970793

191

Czech_Republic

JX970638

177

Norway

JX970653

163

Iran

JX970766

192

Norway

JX970637

178

Norway

JX970652

164

Iran

JX970739

193

Norway

JX970636

179

Russia

JX970651

165

Iran

JX970737

194

Czech_Republic

JX970635

180

Turkey

JX970650

166

Iran

JX970720

195

Turkey

JX970634

181

Norway

JX970649

167

Iran

JX970714

196

Norway

JX970632

182

Czech_Republic

JX970648

168

Iran

JX970687

197

Turkey

JX970631

183

Russia

JX970647

169

Iran

JX970677

198

Iran

JX970831

184

Norway

JX970646

170

Iran

JX970665

199

Iran

JX970830

185

Norway

JX970645

171

Iran

JX970660

200

Iran

JX970822

186

Norway

JX970644

172

 

 

 

Iran

JX970815

187

Norway

JX970643

173

 

میانگین فاصله ژنتیکی بین جمعیت‌های دم‌سرخ معمولی که در ایران زادآوری دارند و در دو کلاد A و B قرارگرفته‌اند مقدار K2P 09/5 محاسبه شد. در شبکه هاپلوتایپی ترسیم‌شده براساس 216 توالی، دو کلاد تشکیل‌شده در درخت تبارشناسی به‌صورت دو شبکه هاپلوتایپی مجزا از هم مورد تأیید قرارگرفتند (شکل 4). اما هاپلوگروپ‌های مجزا براساس منطقه جغرافیایی درون شبکه هاپلوتایپی دیده نمی‌شود و همانطور که مشاهده می‌شود در دو هاپلوگروپ اصلی به‌صورت مختلط پراکنده‌شده است. از میان هفت منطقه موردنظر فقط کشور ترکیه دریکی از دو هاپلوگروپ موجود دیده می‌شود که نشان می‌دهد فقط یک هاپلوگروپ از دم‌سرخ معمولی در این منطقه وجود دارد.

در شکل 5 تغییرات فاصله ژنتیکی (محور y) به‌صورت تابعی از تغییرات فاصله جغرافیایی (محورx) جهت بررسی دقیق‌تر و پاسخ قاطع‌تر به این پرسش که آیا جدایی ژنتیکی تابع جدایی جغرافیایی است یا خیر، نشان داده شده است. رابطه‌ی میزان همبستگی فاصله‌ی جغرافیایی و ژنتیکی با استفاده از آزمون مانتل در جمعیت‌های موجود در کلاد A بررسی شد، زیرا نمونه‌های جوجه آور منطقه البرز را بطور نسبی پوشش داد. اگرچه روند مثبت تابع شاخص جریان ژنی به فاصله جغرافیایی بیانگر کاهش درون آمیزی به ازای افزایش فاصله می‌باشد اما گفتنی است با توجه به ضریب رگرسیون03/0 R² =فاصله جغرافیایی به‌عنوان یک متغیر مستقل بر روی فاصله ژنتیکی اثر معنی‌دار نداشته است (05/0P>). همچنین نمودار PCoA  ترسیم‌شده (شکل6) برای 216 توالی مذکور با تقسیم‌بندی جمعیتی به هفت جمعیت نروژ، ایران، ترکیه، روسیه، چک، اسپانیا، صربستان نشان می‌دهد که جمعیت‌های متعلق به ترکیه درعین‌حال که به لحاظ ژنتیکی به جمعیت‌های منطقه ایران و روسیه و چک نزدیکتر می‌باشد، از سایر جمعیت‌ها به‌صورت مجزا قرارگرفته است. براساس مؤلفه یک جمعیت‌های روسیه، چک و صربستان از سایر جمعیت‌ها جداشده‌اند ولی در نمودار PCoA جمعیت صربستان ناهمخوانی بیشتری را در میان این گروه سه‌تایی از خود نشان می‌دهد و براساس مؤلفه دوم به‌صورت مجزا از جمعیت‌های نروژ و اسپانیا قرارگرفته است. جمعیت‌های نروژ و اسپانیا به علت نزدیکی بیشتر ازنظر فاصله جغرافیایی نسبت به سایر جمعیت‌ها نظم بیشتری ازنظر تشابه ژنتیکی آشکار می‌نمایند.

 

 

 

شکل3- درخت تبارشناختی ژن میتوکندریایی  COIحاصل از تحلیل بیزین مربوط به216 نمونه از بعضی نواحی در منطقه پالئارکتیک

 


بحث و نتیجه‌گیری 

مطالعه جانسن و همکاران (22) واگرایی درون‌گونه‌ای 08/5 % در ژن‌های میتوکندریایی COI، در دم‌سرخ معمولی را نشان داد و دو هاپلوگروپ هم‌جا با بوت استرپ بالا برای این‌گونه تأیید شد که با نتایج ما بر روی دم‌سرخ‌های ایران در محاسبه میانگین فاصله ژنتیکی 09/5 و وجود دو هاپلوگروپ همجا مطابقت داشت.

 

 

شکل 4- شبکه هاپلوتایپی ترسیم شده برای نمونه‌های ایران و برخی مناطق پراکنش دم‌سرخ معمولی در پالئارکتیک. اندازه هر دایره طبق مقیاس نشان‌دهنده نمونه‌های داخل آن هاپلوتایپ است و خطوط تیره بین هاپلوتایپ‌ها نشان دهنده موتاسیون می‌باشد. هاپلوتایپ‌های مربوط به کلاد A در سمت راست و کلاد B در سمت چپ قرارگرفته‌اند.

 

شکل5 - رابطه بین فاصله جغرافیایی(GDD) و میزان جریان ژن (Fst) در هفت جمعیت مورد مطالعه از دم سرخ معمولی موجود در کلاد A
(% 3/0R2= و 1008/0X +05-E 2 (y= 

 

 

 

شکل6 - تحلیل مختصات اصلی (PCoA) ترسیم شده برای نمونه‌های متعلق به هفت جمعیت موجود در کلاد A و تمام جمعیت‌های هر دو کلاد

 

 

هاگنر و همکاران (19) برای کل محدوده دم‌سرخ معمولی در پالئارکتیک، توسط دو ژن میتوکندریایی COI و CR دو هاپلوگروپ مجزا ترسیم کردند. که میزان واگرایی بدست آمده در این مطالعه کمتر از میزان واگرایی بدست آمده در مطالعه ما می‌باشد. در پرندگان دارای پراکنش هم­جا، واگرایی درون‌گونه‌ای زیادی در ژنوم میتوکندریایی در تعدادی از گونه‌ها دیده‌شده است (30، 23، 22، 34 و 4). کر و همکاران (23) نیز در نتایج تحقیق خود به واگرایی درون‌گونه‌ای بالا به‌صورت هم‌جا در گونه دیگری از گنجشک‌سانان آمریکای جنوبی رسیدند که برابر با 5/3 % بود. واگرایی درون‌گونه‌ای بالا به‌صورت هم‌جا تنها در راسته گنجشک‌سانان مشاهده نمی‌شود. سابق بر این نیز دو کلاد مجزا با واگرایی 7/6 % را برای غاز برفی
(Chen caerulescens caerulescens) در ژن میتوکندریایی CR تأییدشده بود (30).

مثبت بودن نمودار شیب تغییرات ژنتیکی نشان می‌دهد با افزایش فاصله بین مکان‌های زادآوری دم‌سرخ‌ها مطابق انتظار از میزان درون آمیزی جمعیت‌ها کاسته می‌شود اگرچه این کاهش در مقایسه با برخی گونه­ها بسیار ملایم می­باشد. برای مثال در مقایسه با دیگر گنجشک­سانان گفتنی است تغییرات Fst با واریانس کمتر برای نوعی سسک تا 5 برابر به ازای فاصله 6000 کیلومتر نشان داده شده (15). اگرچه به دلیل پایین بودن ضریب رگرسیون و عدم معنی‌داری مقدار P-value این کاهش به لحاظ آماری معنی‌دار تلقی نمی‌شود. وسعت پراکنش نمونه‌ها در بیش از 6000 کیلومتر طول جغرافیایی و عدم یکنواختی مسیرهای مهاجرتی می‌تواند باعث پراکندگی ابر نقاط داده‌ها شده باشد. این تفاوت به‌قدری بالاست که در صورت تلفیق افراد درون دو کلاد در یک نمودار جهت شیب معکوس می‌گردد. برخی مطالعات نشان می‌دهد به دلیل جابجایی سالانه نرها و عدم تعلق آنها بین زیستگاه‌های مجاور یک بی‌نظمی درروند جریان ژن حاصل می‌شود که به‌مرور زمان نتیجه آن بصورت پراکنش نامنظم نقاط در نمودار شیب ژنتیکی دیده می‌شود (24). این احتمال وجود دارد که شیب ژنتیکی در ماده‌ها در جهت طول جغرافیایی روند معنی‌دارتری را نمایش دهد. در تحلیل  PCoAبرای روسیه و صربستان تفاوت­هایی دیده می­شود. تفاوت زیستگاه از طول‌های شرقی (روسیه) به سمت غرب (صربستان) همراه با تغییراتی در تنوع ژنتیکی جمعیت‌ها همراه بوده است که هم‌جهت با نروژ و اسپانیا می­باشد. نقشه‌های عمومی مسیرهای مهاجرت برای پرندگان تابستان گذران در بخش‌های اروپایی پالئارکتیک اغلب مسیرهای مشترک و مکان‌های زمستان گذران مجاور به هم را نشان می‌دهد. این وضعیت برای شمال شرق پالئارکتیک متفاوت از منطقه اروپایی آن است، زیرا به نظر می‌رسد گروه‌های دم‌سرخ معمولی پس از عبور از شمال آفریقا و ورود به بخش‌های اروپایی مسیر مهاجرت خود در ادامه راه از یکدیگر اشتقاق یافته و زیستگاه‌های متفاوتی را در کشورهای اروپایی مجاور به هم به‌منظور جوجه­آوری اشغال می‌کنند. در درخت مولکولی این مطالعه دم‌سرخ‌های جوجه­آور اغلب کشورها افرادی در دو کلاد مجزا تحت پوشش قرار می‌گیرند اما به نظر می‌رسد مسیرهای شمال خاورمیانه که شامل ترکیه و ایران می‌باشد از یکدستی بیشتری در گروه کلادی برخوردارند. شواهد این موضوع در نمودار PCoA بین جمعیت ترکیه و ایران مشاهده می‌شود که این بدین معنی است که دم‌سرخ‌های مهاجر به ایران و ترکیه از مناطق زمستان‌گذران نزدیک به هم برخوردار باشند. مطلبی که احتمالاً برای دم‌سرخ‌های غرب پالئارکتیک در کشورهای اروپایی نیز به طور مشابهی مشاهده می‌شود.

1-شهابی، س.، درویش، ج.، و علی‌آبادیان، م.، 1392. بررسی وضعیت آرایه شناختی و تبارزائی جمعیتهای جنس زیبا موش (Calomyscus) در فلات ایران با استفاده از داده‌های ژن میتوکندریاییCOI ، مجله پژوهش‌های جانوری، (6)2، صفحات170- 163.

2- رجبی مهام، ح.، و عزیزی، و.، 1392،بررسی فیلوجغرافیایی موش مقدونیهMus macedonicus petrov & Ruzic, 1983)) در شمال غرب ایران، مجله پژوهش‌های جانوری، (26) 3، صفحات297-289.

 

3. Avise, J.C., 2000. Phylogeography. Harvard Univ. press, Cambridge, Massachusetts London, England, PP: 453.

4. Barrowclough, G.F., Groth, J.G., Odom, K.J., and Lai, J.E., 2011. Phylogeography of the barred owl (Strix varia): species limits, multiple refugia, and range expansion. Auk, 128, PP: 696-706.

5. Bradley, R.D., and Baker, R.J., 2001. A test of the genetic species concept: cytochrome b sequences and mammals. Journal of Mammalogy, 82, PP: 960–973. 

6. Bruford, M.W., Hanotte, O., Brookfield, J.F.Y., and Burke, T., 1992. Single-locus and multilocus DNA fingerprinting In: Molecular genetic analysis of populations: a practical approach (ed. Hoelzel, A. R.), Oxford University Press, New York, PP: 225-269.

7. Burfield, I., Van Bommel, F., Gallo-Orsi, U., Nagy, S., Orhun, C., Pople, R.G., van Zoest, R., and Callaghan, D., 2004.Birds in Europe: population estimates, trends and conservation status: Bird Life International Cambridge.

8. Carr, C.M., Hardy, S.M., Brown, T.M., Macdonald, T.A., and Hebert, P.D., 2011. A tri-oceanic perspective: DNA barcoding reveals geographic structure and cryptic diversity in Canadian polychaetes. PLoS One, 6(7), e22232 p.

9. Clare, E.L., Kim, B.K., Fenton, M.B., and Hebert, P.D.N., 2011. Neotropical bats: estimating species diversity with DNA barcodes. PLOS One, 6, e22648 p.

10. Del Hoyo, J., Elliott, A., and Christie, D.A. eds., 2005. Handbook of the Birds of the World, Vol (10), Cuckoo-Shrikes to Thrushes, Lynx Edicions, Barcelona, PP: 895.

11. De Queiroz, K., 2007. Species concepts and species delimitation, Systematic biology, 56(6), PP: 879-886.

12. Dinca, V., Zakharov, E.V., Hebert, P.D.N., Vila, R., 2011. Complete DNA barcode reference library for a country’s butterfly fauna reveals high performance for temperate Europe. Proceedings of the Royal Society B: Biological Sciences, 278, PP: 347–355.

13. Dickinson, E.C., and Chistdis, E., 2014. The Howard & Moore Coluplete checklist of the birds of the World, Vol (2): Passerines, Aves Press, Eastbourne, PP: 461.

14. Dobzhansky, T., 1937. Genetics and the origin of species. Columbia University Press, New York, PP: 364.

15. Gibbs, H.L., Dawson, R.J., and Hobson, K.A., 2000. Limited differentiation in microsatellite DNA variation among northern populations of the yellow warbler: evidence for male-biased gene flow. Molecular Ecology, 9, PP: 2137-2147.

16. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, PP: 95-98.

17. Hebert, P.D.N., Cywinska, A., Ball, S.L., and Dewaard, J.R., 2003. Biological identifications through DNA barcodes, Proceedings, Biological sciences / The Royal Society, 270(1512), PP: 313-321. 

18. Hebert, P.D.N., Stoeckle, M.Y., Zemlak, T.S., and Francis, C.M., 2004. Identification of Birds through DNA Barcodes, PLoS biology, 2(10), PP: 1657-1663.

19. Hogner, S., Laskemoen, T., Lifjeld, J.T., Porkert, J., Keleven, O., Albayrak, T., Kabasakal, B., and Johnsen, A., 2012. Deep sympatric mitochondrial divergence without reproductive isolation in the common redstart Phoenicurus phoenicurus, Ecology and evolution, 2(12), PP: 2974-2988.

20. Huelsenbeck, J.P., and Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17(8), PP: 754-755.

21. Hull, D.L., 1977. The ontological status of species as evolutionary units, in Foundational problems in the special sciences (R. Butts and J. Hintikka, eds). D. Reidel Publishing Company, Dordrecht, Holland. PP: 91-102.

22. Johnsen, A., Rindal, E., and Ericson, P., 2010.DNA barcoding of Scandinavian birds reveals divergent lineages in trans-Atlantic species. Journal of Ornithology, 151(3), PP: 565-578.

23. Kerr, K.C.R., Lijtmaer, D.A., Barreira, A.S., Hebert, P.D.N., and Tubaro, P.L., 2009. Probing evolutionary patterns in Neotropical Birds through DNA barcodes, PLoS ONE, 4, e4379 p.

24. Kerth, G., Mayer, F., and König, B., 2000. Mitochondrial DNA (mtDNA) reveals that female Bechstein’s bats live in closed societies. Molecular Ecology, 9, PP: 793-800.

25. Leigh, J.W., and Bryant, D., 2015. PopART: full‐feature software for haplotype network construction. Methods in Ecology and Evolution, 6(9), PP: 1110-1116.

26. Lewontin, R.C., 1974. The Genetic Basis of Evolutionary Change. Columbia University Press, New York, PP: 346.

27. Mayr, E., 1942. Systematics and the origin of species from the viewpoint of a zoologist. Columbia Press: New York University, PP: 372.

28. Park, H.Y., Yoo, H.S., Jung, G., and Kim, C.B., 2011. New DNA barcodes for identification of Korean birds, Genes & Genomics, 33(2), PP: 91-95.

29. Peakall, R.O.D., and Smouse, P. E., 2006.GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research, Molecular ecology notes, 6(1), PP: 288-295.

30. Quinn, T.W., 1992. The genetic legacy of Mother Goose- phylogeographic patterns of lesser snow goose (Chen caerulescens caerulescens) maternal lineage. Molecular Ecology, 1, PP: 105-117.

31. Rohlf, R.J., 1993. NTSYS-PC. Numerical Taxonomy and Multivariate Analyses System, Version 1.8. Setauket, New York, PP: 7.

32. Sites, J.W., and Marshall, J.C., 2003. Delimiting species, a Renaissance issue in systematic biology, Trends in Ecology & Evolution, 18(9), PP: 462-470.

33. Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution, 30(12), PP: 2725-2729.

34. Webb, W.C., Marzluff, J.M., and Omland, K.E., 2011. Random interbreeding between cryptic lineages of the common Raven: evidence for speciation in reverse, Molecular Ecology, 20, PP: 2390-2402.