نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه خلیج فارس

2 ایران، بوشهر، دانشگاه خلیج فارس، پژوهشکده خلیج فارس، گروه بیوتکنولوژی

چکیده

ماهی صبیتی بومی خلیج فارس بوده و یک گونه ارزشمند از نظر اقتصادی و آبزی پروری می باشد. در این تحقیق از7 جایگاه میکروستلایتی برای بررسی ساختار جمعیتی ماهی صبیتی استفاده گردید. 170 نمونه ماهی صبیتی از 4 منطقه در خلیج فارس و یک منطقه در دریای عمان مورد بررسی قرار گرفتند. نتایج نشان داد که تعداد الل ها واقعی و موثر بسیار پایین می باشد اما هتروزیگوسیتی مشاهده شده و هتروزیگوسیتی مورد انتظار در حد متوسط بود. انحراف از تعادل هاردی واینبرگ در اکثر لوکوس ها بدلیل استفاده از جایگاههای غیر اختصاصی گونه مشاهد شد. نتایج آماره واریانس مولکولی، شاخص Rst مشخص کرد که 87 درصد از اختلاف ژنتیکی بین افراد و 11 درصد از اختلاف بین جمعیت های بود. جمعیت بوشهر، گناوه و دیر اختلاف معنی داری با یکدیگر نداشتند اما با سایر جمعیت های دارای اختلاف هستند. جمعیت منطقه بندرعباس از جمعیت های مناطق خلیج فارس متمایز بود با این وجود جریان ژنی بالایی بین جمعیت های مختلف جغرافیایی وجود دارد. آنالیز مانتل اختلاف معنی داری را بین جمعیت های جغرافیایی نشان می دهد. آنالیز پیوند همجواری، بوشهر، دیر و گناوه را در یک خوشه و جمعیت بندرعباس را دریک کلاستر جداگانه قرار دارد. بطور کلی می توان گفت جمعیت بندرعباس از جمعیت های خلیج فارس متمایز می باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Genetic diversity Investigation of Silver Seabream Acanthopagrus Cuvieri (Day,1878) in Persian gulf and Oman sea using Microsatellite marker

نویسندگان [English]

  • Ahmad faqihah madani 2
  • Ali Fakhri 2

1 هیات علمی

2 Dept. of Biotechnology, Persian Gulf Institute, Persian Gulf University, Bushehr, I.R. of Iran

چکیده [English]

In this study eight microsatellite DNA loci were used to examine the population genetic structure of Acanthopagrus curvieri, .170 individuals from four sites in Persian Gulf an on Site in Oman Sea were analyzed. The results Showed that number of Na and Ne in locus were very low. But observed heterozygosity, expected heterozygosity and gene diversity of were median. The results of analysis of molecular variance pairwise RST values indicate that, hat 87.54% of the genetic variation contained within populations and 13.46% occurred among populations. The Boushhr and Genaveh and Dayer populations were not significantly different from each other, but significant different from the other population, and khormosa and genaveh samples were also not significantly different from each other, but significantly different from all other samples. The samples were collected form Bandrabbas site was significant different from all other samples in Persian Gulf. The gene flow were estimated (Nm) indicted that existence of high gene flow among populations from 0.994 to 11.114. Neighbour-joining analysis clustered the bandarabas samples far from the others while population collections from Persian Gulf were clustered in one clade. In summery bandarabas population were distinct population from Persian Gulf population.

کلیدواژه‌ها [English]

  • Sobiti
  • Population Genetic
  • Genetic diversity
  • microsatellite
  • Sparidentex hasta

بررسی تنوع ژنتیکی ماهی صبیتی (Sparidentex hasta) در سواحل ایرانی خلیج فارس و دریای عمان با استفاده از روش میکروستلایت

سید احمد قاسمی*، احمد فقیه و علی فخری

ایران، بوشهر، دانشگاه خلیج فارس، پژوهشکده خلیج فارس، گروه بیوتکنولوژی

تاریخ دریافت: 2/12/95                تاریخ پذیرش: 16/11/96

چکیده

ماهی صبیتی بومی خلیج‌فارس بوده و یک‌ گونه ارزشمند از نظر اقتصادی و آبزی‌پروری می‌باشد. در این تحقیق از 7 جایگاه میکروستلایتی برای بررسی ساختار جمعیتی ماهی صبیتی استفاده گردید. 170 نمونه ماهی صبیتی از چهار منطقه در خلیج‌فارس و یک منطقه در دریای عمان مورد بررسی قرارگرفتند. نتایج نشان داد که تعداد الل­ها واقعی و مؤثر بسیار پایین می‌باشد، اما هتروزیگوسیتی مشاهده‌شده و هتروزیگوسیتی مورد انتظار در حد متوسط بود. انحراف از تعادل هاردی واینبرگ در اکثر لوکوس­ها بدلیل استفاده از جایگاه‌های غیراختصاصی گونه مشاهده شد. نتایج آمار واریانس مولکولی، شاخص Rst مشخص کرد که 87 درصد از اختلاف ژنتیکی بین افراد و 11 درصد از اختلاف بین جمعیت‌های بود. جمعیت بوشهر، گناوه و دیر اختلاف معنی‌داری با یکدیگر نداشتند، اما با سایر جمعیت‌ها دارای اختلاف هستند. جمعیت منطقه بندرعباس از جمعیت‌های مناطق خلیج‌فارس متمایز بود بااین‌وجود جریان ژنی بالایی بین جمعیت‌های مختلف جغرافیایی وجود دارد. آنالیز مانتل اختلاف معنی‌داری را بین جمعیت‌های جغرافیایی نشان می‌دهد. آنالیز پیوند همجواری، بوشهر، دیر و گناوه را در یک خوشه و جمعیت بندرعباس را دریک کلاستر جداگانه قراردارد. بطور کلی می‌توان گفت جمعیت بندرعباس از جمعیت‌های خلیج‌فارس متمایز می باشد.

واژه­های کلیدی : ماهی صبیتی، جمعیت، تنوع ژنتیکی،‌ میکروستلایت،  Sparidentex hasta

* نویسنده مسئول، تلفن: 09364855956  ، پست الکترونیکی: aqasemi@gmail.com

مقدمه

 

ماهی صبیتی بانام علمیSparidentex hasta  یکی از ماهیان اقتصادی خلیج‌فارس متعلق به خانواده شانک ماهیان می­باشد. پراکنش ماهی صبیتی بیشتر در خلیج‌فارس و سواحل هند، البته به غرب اقیانوس آرام و شمال استرالیا نیز معرفی‌شده است (12). این ماهی هرمافرودیت پروتاندریک بوده و فصل تخم‌ریزی آن از بهمن تا فروردین می‌باشد (25 و 26) و یکی از گونه‌های مهم و تجارتی خلیج‌فارس به‌حساب می‌آید. بدلیل بازار پسند بودن در کشورهای حاشیه خلیج‌فارس از میزان صید بالایی برخوردار است. ماهی صبیتی یکی از گونه‌های مورد مطالعه برای تکثیر و پرورش می‌باشد که هم‌اکنون به‌صورت مصنوعی تکثیر می‌گردد. به همین دلیل برای بهره‌برداری پایدار ازاین‌گونه و تکثیر موفق آن در جهت اصلاح نژاد نیازمند داشتن اطلاعات تنوع ژنتیکی و ساختار ژنتیکی این‌گونه می‌باشد (5). به دلیل افزایش آلودگی‌ها و بهره‌برداری و صید بی‌رویه ماهی، ذخایر این‌گونه در خلیج‌فارس در حال کاهش می‌باشد،‌ بهره‌برداری از ذخایر آبزیان بدون دانستن ساختار جمعیتی آنها باعث از بین رفتن ساختارهای ژنتیکی جمعیت‌ها و گونه‌ها و همچنین بالا رفتن آسیب‌پذیری گونه‌ها نسبت به شرایط محیطی می‌شود. به‌طورکلی مدیریت تنوع ژنتیکی در موجودات، نیازمند ارزیابی ساختار ژنتیکی و تفکیک ذخایر گونه مورد نظر است. بنابراین آگاهی و بررسی دایمی وضعیت ژنتیکی گونه­هایی که در معرض بهره برداری و صید بی­رویه قرار دارند، برای حفظ و مدیریت آنها ضروری است (17 و 24). کاهش ذخایر آبزیان در دنیا سبب گردیده است که محققین توجه زیادی به روشهای مولکولی برای بررسی جمعیت‌ها و مدیریت ذخایر آبزیان کنند (6 و 9). در دههای اخیر استفاده از نشانگر­های مولکولی همچونMicrosatellite ،RAPD ،RFLP ،AFLP  جهت شناسایی ساختار ژنتیکی ذخایر توسعه یافت. امروزه این نشانگرها به‌طور گسترده‌ای در بسیاری زمینه‌ها از قبیل نقشه­یابی و ردیابی ژن‌ها، تعیین جنسیت، بررسی تنوع ژنتیکی یا روابط ژنتیکی به کار می‌روند (1، 7 و 14). باتوجه به مطالعات گذشته مشخص گردیده که میکروستلایت­ها در اکثر موجودات وجود دارد و در همه موجودات تنوع بسیار بالایی را از خود نشان می‌دهند. نشانگرهای میکروستلایت به دلیل فراوانی و گستردگی بالا در ژنوم، همبارز بودن، توارث مندلی، کوچک بودن اندازه جایگاه ژنی و درنتیجه سهولت تعیین ژنوتیپ از طریق واکنش زنجیرهای پلیمراز و همچنین چندشکلی بالا مناسب‌تر هستند (8و10) مطالعات گذشته در شانک ماهیان بااستفاده از نشانگر میکروستلایت نشان‌دهنده تنوع ژنتیکی بالایی در این‌گونه است اما اختلاف ژنتیکی بین جمعیت‌ها کم می‌باشد (33).

علی‌رغم اینکه ماهی صبیتی از ماهیان اقتصادی و درجه‌یک مناطق جنوب کشور محسوب می‌شود، لیکن تاکنون هیچ‌گونه مطالعه ژنتیکی دراین‌گونه انجام‌نشده است. تنها مطالعه جمعیتی ماهی صبیتی در آبهای ایران با روش AFLP می‌باشد (4). در حال حاضر اطلاعات ژنومی کمی از ماهی صبیتی گزارش‌شده است. لذا برای بررسی جمعیت‌های این‌گونه از پرایمرهای گونه‌های دیگر استفاده گردید در این تحقیق با استفاده از 8 جایگاه میکروستلایتی ماهی شانک زرد باله (38)، ساختار جمعیتی و میزان تنوع ژنتیکی ماهی صبیتی در شمال خلیج‌فارس و دریای عمان بررسی شد.

مواد و روشها

نمونه‌برداری: باتوجه به پراکنش ماهی صبیتی در سواحل شمال خلیج‌فارس شامل خور موسی، گناوه، بوشهر، دیر و بندرعباس به‌عنوان مناطق نمونه‌برداری انتخاب شدند (شکل1). جمع‌آوری نمونه‌ها در سالهای 1389 تا 1391 انجام شد، در هر ایستگاه از ماهیان صیدشده (بوسیله تور و قلاب) توسط قایق‌های صیادی 30 نمونه انتخاب و از باله دمی هرماهی حدود 2 گرم از بافت نرم جداسازی شده و در الکل اتانول مطلق تثبیت شد.

 

 

شکل 1- موقعیت جغرافیایی مناطق نمونه‌برداری از ماهی صبیتی در خلیج‌فارس و دریای عمان

 

استخراج DNA با استفاده ­از روش فنل-کلروفرم (31) انجام گردید. کمیت­ و کیفیت DNA بدست آمده با استفاده ­از الکتروفورژ ژل آگارز یک درصد و اسپکتروفتومتری تعیین گردید.

در این تحقیق با توجه به نبود پرایمرهای اختصاصی میکروستلایتی برای ماهی صبیتی تعداد 8 جفت آغازگر اختصاصی ماهی شانک زرد باله(Acanthopagrus latus) براساس مطالعه ژیا و همکاران (37) انتخاب و پس از سنتز پرایمرها (شرکت متابیون آلمان)، مورداستفاده قرار گرفت (جدول 1). واکنش زنجیره‌ای پلی­مراز برای نمونه‌ها در حجم 5/12 میکرولیتر با شرایط 2 میلی مولار کلرید منیزیم، 200 میکرومولار dNTps، 1 واحد TaqDNA Polymeras و 10 پیکومول از هر پرایمر و 100 نانوگرم DNA ژنومی انجام شد. برنامه گرمایی  PCR(دستگاه ترموسایکلر اپندورف) شامل یک چرخه واسرشت سازی اولیه در دمای 94 درجه سانتیگراد به مدت 3 دقیقه و سپس تعداد 30 چرخه شامل واسرشت سازی ثانویه در دمای 94 درجه سانتیگراد به مدت 30 ثانیه، اتصال آغازگرها به رشته DNA، بسته به نوع آغازگر (جدول1) به مدت 30 ثانیه، بسط در دمای 72 درجه سانتیگراد به مدت 30 ثانیه و درنهایت یک چرخه بسط نهایی در دمای 72 درجه سانتیگراد به مدت 3 دقیقه بود.

 

جدول 1- توالی پرایمر جایگاههای مورداستفاده در واکنش PCR انتخابی

Locus

Repeat motif

Primer sequences (5′–3′)

R (bp)

Ta(°C)

Accession no.

S15

(GT)20

F: GCGGGAAAACATGTCATT

145 –158

58

DQ222444

 

 

R: AATTGAAGGGTGAGGGGTCA

 

 

 

S16

(CA)21

F: GAGCAGAGCAGCGGACATC

180 –250

58

DQ222445

 

 

R: TGCATGTTTATGTACCGCATAC

 

 

 

S18

(GT)19

F: CGTTTCACTGGAAAACACC

210-260

58

DQ222446

 

 

R: TCTGTGACAGGATGCTGACTTA

 

 

 

S19a

(CA)20

F: GATATAATAGAGGGGTTGACA

250-268

58

DQ222447

 

 

R: CACTGAGCGCTTGCTT

 

 

 

S30

(CA)38

F: GCGCTTTATTGTTCTGGGTTAC

196-230

58

DQ222448

 

 

R: GAATAGACTGGTGAGGCGTCA

 

 

 

S32

(GT)20

F: GCCAGCGCACTGTGTTGTTATT

175 –231

58

DQ222449

 

 

R: GCGCTGAAGCTCCGTTACTTTA

 

 

 

S34

(GT)30

F: GAAGGATAGAGGAGGTGTGG

156 –190

58

DQ222450

 

 

R: ATCACATGCACACGCAGAC

 

 

 

S35a

(GT)20

F: CGCATACATGTTACAAGTCAC

160 –192

58

DQ222451

 

 

R: CGGACATCATTATGATTCTA

 

 

 

 

پس از انجام واکنش PCR، برای جداسازی باندها در محصول PCR از ژل پلی­اکریل آمید 6 درصد و برای آشکارسازی باندها از روش نیترات نقره استفاده گردید (32) و از الگوی باندی بدست آمده عکس‌برداری گردید و توسط نرم ‌افزار کوانتی وان (Bio-Rad) باندها ارزش‌گذاری شدند.

آنالیز آماری: ابتدا با استفاده از نرم‌افزار میکروچکر ورژن 2.2.3 (35) تست الل­ای نول انجام گرفت. ماتریکس الل­های میکروستلایتی بدست آمده در فرمت اکسل وارد و با استفاده از نرم افراز کریت به فرمت نرم ‌افزارهای ژن پاپ 2.9.4 (30) و ارلیگویین 3.5  (11) درآمد.

پارامترهای تنوع ژنتیکی شامل: تعداد الل­ها، هتروزایگوسیتی مشاهده‌شده و مورد انتظار، تعداد الل مؤثر در هر لوکوس و در هر جمعیت با نرم‌افزارGenAlEx6.4  محاسبه گردید. انحراف از تعادل هاردی وایبرگ و شاخص Fis و غنای اللی در نرم‌افزار FSTAT 2.9.4 (16) محاسبه شد.

برای   محاسبه    میزان    اختلاف    ژنتیکی   بین   مناطق

نمونه‌برداری از شاخص Fst استفاده گردید و آنالیز واریانس مولکولی(Analysis of MOlecular VAriance) برای محاسبه Fst و Rst استفاده شد. آنالیز واریانس ملکولی (تست AMOVA) در سطح خطای 01/0 با 1000 بار تکرار در نرم‌افزار GeneAlex (27)، آنالیز PCA  (Principal coordinate analysis) در نرم‌افزار GenAlEx 6.4  با استفاده از اختلاف ژنتیکی بین جمعیت‌ها ترسیم گردید. تست تنگنای ژنتیکی براساس مدل جهـش دوفازی(TPM)، مـدل جهش گام‌به‌گام(SMM) و بی‌نهایت (IAM) با استفاده از نرم‌افزار باتلنک 1.2 انجام گرفت.

نتایج

از 8 جفت پرایمر مورداستفاده دراین پژوهش 7 جایگاه پلی­مورف بوده و حداقل دو باند را نشان دادند. براساس نتایج بدست آمده دراین بررسی مجموعاً 47 الل پلی­مورف در هفت لوکوس میکروستلایتی با میانگین 8/6 الل برای هر لوکوس شناسایی شد. لوکوس های S35 با 10 الل بیشترین تعداد الل را داشت و لوکوس S32 با 5 الل کمترین تعداد الل پلی­مورفیسم را نشان داد. چهار الل اختصاصی، الل شماره 9 در لوکوس SA30 مربوط به منطقه دیر، الل شماره  6 در لوکوس S16 مربوط به منطقه دیر، الل شماره 5 و 6 در لوکوس S18 مربوط به منطقه دیر شناسایی شد. دراین مطالعه دامنه هتروزیگوسیتی مشاهده ‌شده بین 86/0 تا 9/0 با میانگین 87/0 و دامنه هتروزیگوسیتی مورد انتظار بین 75/0 تا 85/0 با میانگین 72/0 محاسبه گردید. در تمامی لوکوس­ها مقادیر هتروزیگوسیتی مشاهده‌شده بیشتر از هتروزیگوسیتی مورد انتظار محاسبه گردید (جدول 2). همچنین بیشترین هتروزایگوسیتی مشاهده‌شده در جمعیت بوشهر به میزان 9/0 و بیشترین هتروزایگوسیتی مورد انتظار در جمعیت بندرعباس مشاهده شد. میزان He و Ho بین جمعیت‌های خور موسی، گناوه ، بوشهر، دیر اختلاف معنی‌داری را نشان نداد. میانگین شاخص شانن 46/1 و بیشترین میزان این شاخص در نمونه‌های بندرعباس (6/1) بدست آمد. میانگین تعداد الل در لوکوس­های مختلف 6/5 و میانگین الل 06/4 بود. بیشترین الل واقعی و مؤثر در جمعیت بندرعباس محاسبه گردید. میانگین الل مؤثر و الل واقعی در جمعیت‌های خور موسی، دیر، بوشهر و گناوه اختلاف معنی‌داری نشان نمی‌دهد.

دربررسی تعادل هاردی - واینبرگ در لوکوس‌های مختلف نشان داد که تنها لوکوس S18 در جمعیت خورموسی، بوشهر و بندرعباس اختلاف معنی‌داری را نشان نداد. در سایر جایگاه‌ها انحراف از تعادل هاردی- واینبرگ مشاهده می‌گردد. همچنین هیچ‌کدام از پنج لوکوس عدم تعادل پیوستگی را نشان ندادند.

 

جدول2- شاخص‌های تنوع ژنتیکی (N: تعداد نمونه، Na الل واقعی،Ne الل مؤثر) شاخص شانن، هتروزایگوسیتی مورد انتظارHe و مشاهده‌شده Ho، WHE تعادل هاردی واینبرگ وF شاخص درون‌زاد آوری) در جمعیت‌های ماهی صبیتی

Pop

 

S15

S30

S16

S18

S19a

S35

S32

Mean

SE

خورموسی

N

00/30

28

00/30

00/30

00/30

00/30

00/30

71/29

29/0

 

Na

00/5

00/8

00/5

00/5

00/6

00/5

00/5

00/5

58/0

 

Ne

53/2

60/5

60/2

71/2

88/5

56/5

09/3

69/3

59/0

 

I

02/1

87/1

09/1

15/1

66/1

56/1

23/1

37/1

12/0

 

Ho

93/0

93/0

00/1

73/0

00/1

00/1

70/0

90/0

05/0

 

He

59/0

82/0

62/0

63/0

80/0

78/0

68/0

70/0

05/0

 

WHE

60/0

85/0

63/0

65/0

81/0

79/0

69/0

71/0

05/0

 

F

-59/0

-13/0

-62/0

-16/0

-26/0

-28/0

-05/0

-30/0

09/0

گناوه

N

00/30

00/29

00/30

00/30

00/30

00/30

00/30

86/29

15/0

 

Na

00/5

00/7

00/5

00/3

00/6

00/9

00/5

57/5

75/0

 

Ne

65/3

55/5

98/3

70/2

31/5

79/7

06/3

28/5

63/0

 

I

51/1

62/1

58/1

05/1

57/1

12/2

25/1

50/1

13/0

 

Ho

90/0

93/0

00/1

93/0

00/1

90/0

63/0

90/0

05/0

 

He

73/0

78/0

75/0

63/0

77/0

87/0

67/0

75/0

03/0

 

WHE

75/0

79/0

76/0

65/0

78/0

89/0

68/0

75/0

03/0

 

F

-25/0

-20/0

-35/0

-58/0

-30/0

-03/0

06/0

-22/0

07/0

بوشهر

N

00/30

00/30

00/30

00/30

00/30

00/29

00/30

86/29

15/0

 

Na

00/5

00/8

00/5

00/5

00/6

00/9

00/5

86/5

75/0

 

Ne

69/3

59/5

57/3

71/2

16/5

32/6

88/2

26/5

53/0

 

I

51/1

82/1

50/1

09/1

71/1

01/2

18/1

52/1

13/0

 

Ho

93/0

93/0

00/1

97/0

00/1

76/0

50/0

86/0

08/0

 

He

73/0

82/0

72/0

63/0

81/0

85/0

65/0

75/0

03/0

 

WHE

75/0

83/0

73/0

65/0

82/0

86/0

66/0

76/0

03/0

 

F

-28/0

-15/0

-39/0

-53/0

-25/0

10/0

39/0

-16/0

12/0

دیر و گنگان

N

00/30

00/30

00/30

00/29

00/30

00/29

00/30

71/29

18/0

 

Na

00/5

00/8

00/5

00/3

00/5

00/10

00/5

57/5

95/0

 

Ne

11/3

61/5

15/2

29/2

59/3

10/7

55/2

77/3

71/0

 

I

25/1

85/1

85/0

91/0

53/1

10/2

17/1

36/1

18/0

 

Ho

97/0

00/1

00/1

76/0

97/0

93/0

23/0

85/0

11/0

 

He

68/0

82/0

53/0

56/0

72/0

86/0

61/0

68/0

05/0

 

WHE

69/0

85/0

55/0

57/0

73/0

87/0

62/0

70/0

05/0

 

F

-53/0

-22/0

-88/0

-35/0

-35/0

-08/0

62/0

-25/0

17/0

بندرعباس

N

00/30

00/29

00/30

00/30

00/30

00/30

00/30

86/29

15/0

 

Na

00/5

00/8

00/5

00/6

00/6

00/9

00/5

29/6

61/0

 

Ne

67/3

29/5

30/5

52/3

23/5

00/5

57/3

35/5

32/0

 

I

55/1

85/1

51/1

50/1

72/1

76/1

51/1

60/1

06/0

 

Ho

90/0

00/1

00/1

73/0

90/0

00/1

53/0

87/0

07/0

 

He

73/0

81/0

77/0

71/0

81/0

80/0

71/0

76/0

02/0

 

WHE

75/0

83/0

78/0

72/0

82/0

81/0

72/0

77/0

02/0

 

F

-25/0

-23/0

-30/0

-05/0

-11/0

-25/0

25/0

-13/0

07/0

 

 

بر اساس شاخص (1972) Nei بیش‌ترین فاصله ژنتیکی و کمترین شباهت ژنتیکی بین جمعیت‌های خورموسی و بندرعباس به ترتیب با 23/0 و 80/0 و کمترین فاصله ژنتیکی و بیش‌ترین شباهت ژنتیک بین جمعیت‌های خورموسی و گناوه به ترتیب با 07/0 و 93/0 محاسبه گردید (جدول3). آنالیز PCA براساس فاصله ژنتیکی و شباهت ژنتیکی نشان داد که جمعیت‌ها بوشهر و دیر در ارتباط نزدیک با یکدیگر و خورموسی و گناوه شباهت بالایی را نشان می‌دهند. جمعیت بندرعباس یک جمعیت مجزا را نشان می‌دهد (شکل 2). میزان شاخص Fst در حد پایینی می‌باشد کمترین میزان بین جمعیت‌های گناوه و خورموسی و بیشترین میزان بین خورموسی و بندرعباس بود.

 

جدول3- شاخص‌های تمایز جمعیتی ماهی صبیتی

جمعیت1

جمعیت2

Nei D

Nei I

Fst

Nm

Rst

P(rand >= data)

خورموسی

گناوه

07/0

93/0

01/0

29/19

10/0

00/0

خورموسی

بوشهر

12/0

89/0

02/0

26/12

25/0

00/0

گناوه

بوشهر

05/0

95/0

01/0

56/32

03/0

06/0

خورموسی

دیر

12/0

89/0

02/0

26/10

21/0

00/0

گناوه

دیر

12/0

88/0

02/0

33/10

05/0

02/0

بوشهر

دیر

06/0

95/0

01/0

05/19

02/0

07/0

خورموسی

بندرعباس

23/0

80/0

1/0

59/6

08/0

00/0

گناوه

بندرعباس

15/0

86/0

02/0

76/10

07/0

00/0

بوشهر

بندرعباس

20/0

81/0

03/0

29/8

15/0

00/0

دیر

بندرعباس

12/0

80/0

05/0

15/16

10/0

00/0

1

 

شکل2- قرابت میان جمعیت ماهی صبیتی با استفاده از تجزیه مؤلفه‌های اصلی

 

در آزمون AMOVA تمایز جمعیت‌های مختلف به‌صورت دوبه‌دو براساس شاخص Rst محاسبه شد و براین اساس بیش‌ترین میزان Rst میان جمعیت بندرعباس و خورموسی (025/0) و کمترین میزان شاخص Rst بین جمعیت گناوه و خورموسی مشاهده گردید. حداکثر میزان مهاجرت (02/32Nm=) بین جمعیت‌های گناوه و بوشهر و کمترین میزان مهاجرت (51/6Nm=) بین جمعیت‌ها بندرعباس و خورموسی محاسبه گردید (جدول 3). براساس آنالیز واریانس مولکولی دو شاخص Fst و Rst، بین جمعیت‌های گناوه، بوشهر و دیر اختلاف معنی‌داری وجود ندارد. بین جمعیت‌های گناوه و خورموسی در سطح 5 درصد اختلاف معنی‌دار می‌باشد. جمعیت بندرعباس و خورموسی دارای اختلاف ژنتیکی معنی‌دار بودند همچنین جمعیت بندرعباس با سایر جمعیت‌ها اختلاف ژنتیکی معنی‌داری را نشان می‌دهند (جدول 3).

اختلاف تنوع ژنتیکی براساس سلسله مراتب جمعیتی، 5 جمعیت و 3 منطقه براساس آزمون AMOVA در سطح احتمال 01/0 براساس شاخص Rst محاسبه گردید. براین اساس بیش‌ترین درصد اختلاف 87 درصد مربوط به بین افراد درون جمعیت‌ها می‌باشد و کمترین درصد اختلاف ژنتیکی 3 درصد به تفاوت میان جمعیت‌های در مناطق فرض شده بود. و اختلاف ژنتیکی بین مناطق فرض شده 11 درصد محاسبه گردید (جدول 4). شاخص Rst نشان داد که اختلاف ژنتیکی معنی‌داری بین جمعیت بندرعباس با 4 جمعیت دیگر وجود دارد (01/0P<). همچنین جمعیت خورموسی با بوشهر و دیر در سطح 99 درصد اختلاف ژنتیکی معنی‌دار دارد اما با جمعیت گناوه در سطح 95 درصد اختلاف معنی‌دار می‌باشد. جمعیت‌های گناوه، بوشهر و دیر اختلاف ژنتیکی معنی‌داری را با یکدیگر نشان نمی‌دهند (01/0P<).

 

جدول4- آزمون تفاوت ژنتیکی بین جمعیت‌ها بربر اساس آزمون Rst

اختلاف واریانس

df

SS

MS

Est. Var.

درصد

 

بین گروهها

2

25/399

41/199

880/1

11%

P<01/0

بین جمعیت‌های درون گروهها

2

84/92

42/46

460/0

3%

 

بین افراد درون جمعیت‌ها

170

4357

38/28

88/13

87%

P<01/0

کل

339

6/4850

 

12/17

100%

 

                                                                                                                                                                 

 

آزمون مانتل براساس فاصله ژنتیکی و فاصله جغرافیایی بین جمعیت‌ها نشان می‌دهد که همبستگی بین فاصله جغرافیایی و اختلاف ژنتیکی وجود دارد میزان R نشان دهند میزان بالایی از همبستگی می‌باشد (01/0P<). (شکل 4).

 

 

شکل 4- اختلاف ژنتیکی جمعیت‌های ماهی صبیتی در مقایسه بافاصله جغرافیایی بین جمعیت‌ها

 

تست تنگنای ژنتیکی جمعیت‌های ماهی صبیتی براساس مدل جهـش دوفازی (TPM)، مـدل جهش گام‌به‌گام (SMM) و بی‌نهایت(IAM) محاسبه شد بر این اساس در هیچ جمعیتی تنگنای ژنتیکی مشاهده نمی‌گردد (جدول 5).

 

جدول5- تست تنگناری ژنتیکی جمعیت‌های ماهی صبیتی (مدل جهـش دوفازی(TPM)، مـدل جهش گام‌به‌گام(SMM) و بی‌نهایت(IAM))

جمعیت

PIAM

PSMM

PTPM

Mod-shift

خورموسی

023/0

026/0

022/0

L-shaped

گناوه

025/0

023/0

021/0

L-shaped

بوشهر

024/0

025/0

023/0

L-shaped

دیر

19/0

14/0

022/0

L-shaped

بندرعباس

42/0

24/0

25/0

L-shaped

 

بحث

متوسط تعداد الل مشاهده‌شده در جایگاههای مختلف ماهی صبیتی 7 الل می‌باشد که نسبت به متوسط تعداد الل در ماهیان دریایی پایین‌تر است. به‌طورکلی متوسط تعداد الل در هر لوکوس در ماهیان آب‌شور 6/20 الل است (10). تعداد الل بدست آمده در همین جایگاه‌ها در ماهی شانک(A. latus) (38) نیز بیشتر گزارش‌شده است. تعداد الل در گونه‌های خانواده شانک ماهیان بسیار متفاوت گزارش‌شده است برای مثال تعداد الل واقعی در ماهی شانک زرد باله در مطالعه سایزنی  و همکاران (33) از 22 تا 47 عدد در جایگاههای مختلف می‌باشد. در ماهی Pagrus major تعداد 47 الل در سه لوکوس در 8 جمعیت در جنوب غرب ژاپن بدست آمد (28) در حالیکه که بین 15 تا 32 الل در جمعیت‌های غرب ژاپن برای همین‌گونه گزارش‌شده است (29). در ماهی شانگ سیاه تعداد 6 تا 21 الل در جایگاههای میکروستلایتی بدست آمده است (20) در حالیکه در همین‌گونه در جمعیت خلیج هیروشیما تعداد 7 تا 24 الل بدست آمده است (15). تعداد الل مشاهده در ماهی صبیتی نسبت به دیگرگونه‌های این خانواده بسیار پایین‌تر می‌باشد. مهمترین دلیل آن استفاده از پرایمرهای غیراختصاصی دراین تحقیق می‌باشد همچنین نتایج نیز نشان داد که الل­های نول در جایگاه‌ها وجود دارد. ماهی صبیتی در مقایسه با ماهی شانک زرد باله یا شانک سیاه دارای پراکنش جهانی نمی‌باشد و محدود به خلیج‌فارس، خلیج عدن و دریای عمان است این محدودیت جمعیتی و پراکنش می‌تواند عاملی در کاهش تنوع اللی و ژنی این‌گونه باشد. کاهش تعداد الل واقعی و مؤثر در سطح جمعیت بیانگر کاهش تنوع ژنتیکی است. این تغییر بصورت کاهش فراوانی الل و از بین رفتن الل­های نادر صورت می‌گردد (25).

میانگین هتروزایگوسیتی مورد انتظار و مشاهده‌شده به ترتیب 72/0 و 88/0 محاسبه گردید. این میزان از تنوع ژنتیکی در حد متوسط گونه‌های دریایی می‌باشد (10). این میزان از هتروزایگوسیتی در گونه‌هایP. major  و
 A. schlegeliiدر آبهای ژاپن و آبهای دریای چین نیز گزارش ‌شده است (21 و 28). اما میزان هتروزایگوسیتی مورد انتظار و مشاهده‌ شده بدست آمده در مطالعه سایزنی و همکاران (33) در ماهی شانک زرد باله حد بسیار بالا (91/0) بوده است. بطور کلی در مطالعات جمعیتی میزان تنوع بالایی شانک ماهیان گزارش‌شده است (33 و 37). در مطالعه گذشته (4) با روش AFLP میزان متوسطی از تنوع ژنتیکی در ماهی صبیتی گزارش‌شده است. آنالیز میکروستلایتی ماهی صبیتی نشان می‌دهد که تنوع ژنتیکی این‌گونه در حد متوسطی در جمعیت‌های خلیج‌فارس می‌باشد. به‌طورکلی تعداد کم الل نشانه‌ای از تنگنای ژنتیکی است که در شرایط جمعیت وحشی، ممکن است به دلیل جدا شدن جمعیت و یا کاهش شدید اندازه جمعیت مؤثر به دلیل صید و بهره‌برداری زیاد رخ دهد (3). بیشترین هتروزیگوسیتی در جمعیت بندرعباس می‌باشد. که می‌توانند ناشی از ارتباط با جمعیت‌های دریای عمان و جمعیت‌های بزرگتر این‌گونه باشد. در سایر مناطق اختلافی در تنوع ژنتیکی وجود ندارد. پس از اعمال ضریب بونفرونی، 30 تست از مجموع 35 تست در لوکوس­های مختلف انحراف از تعادل هاردی-واینبرگ را نشان می‌دهند. در10 جایگاه میکروستلایتی بررسی‌شده در ماهی شانک در شرق ژاپن تنها در یک مورد عدم تعادل مشاهده گردیده است (33). عدم تعادل پیوستگی به‌عنوان یکی از دلایل انحراف از تعادل هاری واینبرگ در 4 لوکوس مشاهده گردید. همچنین الل­های نول در جایگاه‌ها مشاهده می‌گردد. انحراف از تعادل هاردی-واینبرگ را می‌توان به وجود الل­های نول در جمعیت‌های موردبررسی نسبت داد. درواقع وجود الل­های نول در ماهی پدیده­های کاملاً عادی می‌باشد وجود این الل­ها در توارث میکروستلایت در ماهیان مورد تأیید قرارگرفته است (25). اگرچه تنها در دو جایگاه الل­های نول مشاهده گردید. عدم تعادل هاردی واینبرک در ماهیان دریایی دیگر ازجمله سوکلا (1)، ماهی شیر(2) مشاهده می‌گردد. دراین تحقیق، افزایش هتروزیگوسیتی مشاهده می‌شود زیرا که میزان هتروزیگوسیتی مشاهده‌ شده از میزان هتروزیگوسیتی مورد انتظار بیشتر بود. که یکی دیگر از دلایل انحراف از تعادل می‌باشد (23).

دراین بررسی میزان Fst بین جمعیت‌های مختلف ماهی صبیتی از 01/0 تا 1/0 بود این میزان نشان‌دهنده تمایز پایین بین جمعیت‌ها می‌باشد (34). باتوجه به جریان ژنی بالا بین مناطق، پایین بودن تمایز قابل توجیه می‌باشد. با تبادل افراد، تبادل ژن‌ها نیز پیش می‌آید و تبادل بیشتر منجر به کم شدن تمایز ژنتیکی بین جمعیت‌ها می‌گردد. در بررسی حیاوی (4)، کمترین مقدار Fst بین جمعیت بوشهر و خورموسی (09/0) و بیشترین مقدار Fst بین جمعیت مطاف و خورموسی (219/0) محاسبه شد.  تمایز ژنتیکی تقریباً بالا بین جمعیت مطاف در شرق خلیج‌فارس و جمعیت‌های بوشهر و خورموسی در غرب خلیج‌فارس وجود داشت. ایشان علت تمایز را ناشی از مهاجرت کم جمعیت‌های این‌گونه بین مناطق مورد پراکنش عنوان نمودند که با بیولوژی این‌گونه که سرعت شنای کندی دارد و دارای مهاجرت‌های عمودی می‌باشد نیز مطابق است (4).

آنالیز واریانس مولکولی به‌عنوان یک آنالیز آماری، ابزاری مناسب برای مشخص کردن ساختار جمعیت و میزان تمایز ژنتیکی بین جمعیت‌ها است (13). نتایج آزمون واریانس مولکولی دراین بررسی براساس شاخص Rst، تنوع ژنتیکی بالایی را در داخل جمعیت‌ها (87 درصد) و اختلاف ژنتیکی پایین بین جمعیت‌ها (11 درصد) مشاهده شد. میزان Rst بین جمعیت‌های مختلف نشان داد که جمعیت بندرعباس از جمعیت بوشهر، خورموسی، دیر و گناوه متمایز می‌باشد اما نمونه‌های سه منطقه بوشهر، گناوه و دیر تمایزی باهم ندارند. عدم وجود اختلاف بین جمعیت‌های ماهی صبیتی به دلیل نرخ بالایی مهاجرت (Nm>10) می‌باشد هرگاه Nm>1 جریان ژنی اصلی‌ترین عامل در ایجاد تمایز ژنتیکی است (25). دوره زندگی ماهی صبیتی در مرحله لاروی و نوجوانی بصورت پلاژیک بوده و به آن اجازه می‌دهد که با جریانات جابجا و جمعیت‌ها مخلوط گردند (33). مهمترین جریان دریایی خلیج‌فارس جریان آب از سمت تنگه هرمز به سمت شمال خلیج‌فارس، در جهت سواحل ایران می‌باشد این جریان تا میانه خلیج‌فارس شدیدتر از قسمت شمالی در خوزستان است (21). همچنان که در جمعیت بندرعباس به دلیل فاصله جغرافیایی و نوع جریانات منطقه با جمعیت‌های شمال خلیج‌فارس اختلاف ژنتیکی را نشان داد. این جریانهای آبی در انتقال لارو ماهیان و موجودات نقش مهمی دارد. در آبهای غرب چین نیز اختلاف ژنتیکی بین جمعیت‌های ماهی شانک زرد باله مشاهده نشده است. سایزنی و همکاران (33) دلیل اصلی عدم تمایز جمعیتی را جریان بالای ژنی بین جمعیت‌ها عنوان کردند. مطالعات جین و همکاران (19) نیز نشان داد که ماهی شانک زرد باله در آبهای تایوان دارای یک جمعیت است که اختلاف ژنتیکی کمی با یکدیگر دارند. که بدلیل مانسون فصل زمستان، جریانات سطحی آب باعث پراکنش لاروها و بچه ماهیان می‌گردد همچنین جریانهای اقیانوسی در پراکنش لاروها این‌گونه مؤثر هستند. اما جونگ و همکاران (20) عدم اختلاف ژنتیکی بین جمعیت‌های ماهیA. schlegelii  را پراکنش تصادفی تخم‌ها بدلیل مهاجرت والدین می‌دانند.  

برخی از اعضای خانواده شانک ماهیان دارای مهاجرت گسترده در یک منطقه محدود در طول چرخه زندگی خود هستند (19 و20). به‌عنوان‌مثال مهاجرت ماهیA. butcheryتنها در مصب رودخانه انجام می‌گیرد (18). اما کرواس و همکاران (22) عنوان کردند که ماهی Chrysoblephus laticeps مهاجرت محدود در حد 3 کیلومتر دارند. به‌طور مشابه، جمعیت‌هایDiplodus sargus تمایل به ماندن در یک محدوده کوچک یا مصب را دارند. رفتارشناسی شانک ماهیان، نشان می‌دهد که مولدین دارای مهاجرت بالایی نمی‌باشند بنابراین، جریان ژن بالا در جمعیت‌ها به‌احتمال‌زیاد به دلیل پراکندگی تصادفی تخم دریایی و لارو این ماهیان است (33). در جمعیت‌های ماهی صبیتی در خلیج‌فارس نیز اختلافی بین مناطق بوشهر، گناوه، دیر و خورموسی مشاهده نمی‌گردد که می‌تواند بدلیل فاصله کم این مناطق و درنتیجه جریان ژنی بالا باشد. حداکثر فاصله بین این مناطق 300 کیلومتر است که باتوجه به میزان مهاجرت ماهی صبیتی احتمال تمایز بین جمعیت دراین مکان کم می‌باشد. در مقابل در منطقه بندرعباس بافاصله جغرافیایی بیش از 600 کیلومتر دارای اختلاف معنی‌دار با جمعیت‌های بوشهر و دیر بود. برای مثال جمعیت‌های ماهی شانک را در دریای چین در شمال و جنوب بدلیل فاصله زیاد از یکدیگر متمایز می‌باشند (35). یا جمعیت‌های ماهیSparus aurata  در آبهای مدیترانه از جمعیت‌های این‌گونه در داخل اقیانوس اطلس متفاوت هستند. عامل فاصله جغرافیایی را دلیل تمایز بین این جمعیت‌ها ذکر شده است (13). آزمون مانتل براساس فاصله ژنتیکی نشان داد که عامل فاصله جغرافیایی در تمایز جمعیت‌های ماهی صبیتی نقش مهمی دارد. ماهیان هر منطقه با مناطق مجاور خود دارای تبادل ژنی هستند و با افزایش فاصله میزان اختلاف ژنتیکی افزایش می‌یابد. 

جریانات دریایی نقش مهمی در پراکنش لارو و بچه ماهیان شانک می‌باشند (33) درنتیجه عوامل جغرافیای در دریا می‌تواند محدودکننده ارتباط بین جمعیت‌ها باشد. باتوجه به اینکه در دریاها عوامل محدودکننده کم هستند عامل تعیین‌کننده برای جدایی جمعیت‌ها فاصله می‌باشد. جمعیت‌های ماهی Sparus aurata در داخل مدیترانه (آبهای ایتالیا) متمایز از جمعیت‌های اقیانوس اطلس هستند (13). در آبهای چین باوجود جریان‌های دریایی اما جمعیت‌های متمایزی در شمال و جنوب دریایی چین (بیش از 1000 کیلومتر) شناسایی گردیده است (35) اما در غرب ژاپن در فاصله 300 کیلومتر جمعیت متمایزی مشاهده نگردیده است. دراین مطالعه نیز جمعیت‌های بافاصله کمتر از 300 کیلومتر باهم متمایز نمی‌باشند اما جمعیت‌های بندرعباس و جمعیت‌های درون خلیج‌فارس بافاصله بیش از 600 کیلومتر از یکدیگر متمایز هستند.

بطورکلی نتایج نشان داد که تنوع اللی بسیار پایینی در ماهی صبیتی باله وجود دارد که احتمالاً بدلیل نوع جایگاههای غیراختصاصی بکار گرفته‌شده باشد بطور کلی تنوع ژنتیکی بدست آمده در جمعیت‌ها ماهی صبیتی در حد متوسطی است. براساس اختلاف ژنتیکی و آنالیز واریانس مولکولی، جمعیت بندرعباس از جمعیت‌های درون خلیج‌فارس متمایز می‌باشد و همچنین جمعیت خورموسی می‌تواند یک جمعیت متمایز از جمعیت‌های بوشهر و دیر باشد. جمعیت‌های ماهی صبیتی اگرچه از یکدیگر متمایز می‌باشند اما کاملاً جمعیت‌های مجزا و خاص یک منطقه نمی‌باشند و دارای تبادل ژنی بالایی با یکدیگر می‌باشند. بنابراین می‌توان گفت عامل اصلی تمایز جمعیت ماهی صبیتی فاصله جغرافیایی و جریانهای دریایی از تنگه هرمز به سمت شمال خلیج‌فارس می‌باشد.

1- سالاری علی‌آبادی، م. ع.، 1387. بررسی ساختار ژنتیکی جمعیت‌های ماهی سوکلا (Rachycentron canadun) در خلیج‌فارس و دریای عمان با استفاده از روش مولکولی میکروستلایت، پایان‌نامه دکتری، دانشگاه علوم و فنون دریایی خرمشهر، 191صفحه.

2- عابدی، ا.، ذوالقرنین، ح.، سالاری علی‌آبادی، م. ع.، محمدی، م.، و قاسمی، ا.، 1389. بررسی تنوع ژنتیکی جمعیتهای شیر ماهی(Scomberomorus commerson) در خلیج‌فارس با استفاده از نشانگرهای میکروستلایت، پایان‌نامه کارشناسی ارشد، دانشگاه علوم و فنون دریایی خرمشهر، 109صفحه.

3- رضایی، م، شعبانی، ع، شعبان پور، ب.، و کشیری، ح.، 1391. تنوع ریزماهواره ای و ساختار ژنتیک جمعیت ماهی سفید
Rutilus frisii kutum در سواحل استان مازندران،‎ مجله زیست‌شناسی ایران، جلد4، شماره 21، ص 558-548.

4- حیاوی، ز.، 1394. بررسی تنوع ژنتیکی ماهی صبیتی (Acanthopagrus Curvieri. Day, 1878) در سواحل شمالی خلیج‌فارس با استفاده از روش AFLP، پایان‌نامه کارشناسی ارشد، شیلات گرایش تکثیر و پرورش، دانشگاه آزاد واحد بوشهر، 88 صفحه.

5- مرشدی، و.، آق، ن.، مرمضی، ج.، نوری، ف.، و محمدیان، ف.، 1394. بررسی فعالیت آنزیم‌های گوارشی، ترکیب بیوشیمیایی لاشه و فلور باکتریایی روده بچه ماهی صبیتی (Sparidentex hasta) در پاسخ به سطوح مختلف زایلواولیگوساکارید، فیزیولوژی و تکوین جانوری (علوم زیستی)، دوره 8، شماره 4 (پیاپی 31).

 

6- Adams, B. K., and Hutchings, J. A., 2003. Microgeographic population structure of brook charr: a comparison of microsatellite and mark‐recapture data. Journal of fish biology, 62(3), PP: 517-533.

7- Avise, J., 2004. Molecular markers, Natural History and Evolution. Chapman and Hall, New York, USA, 511 p.

8- Chen, L., Li, Q., and Yang, J., 2008. Microsatellite genetic variation in wild and hatchery populations of the sea cucumber (Apostichopus Japonicus Selenka) from northern China. Aquaculture, Research. 39, PP: 1541-1549.

9- Chistiakov, D. A., Hellemans, B., Haley, C. S., Law, A. S., Tsigenopoulos, C. S., Kotoulas, G., Bertotto, D., Libertini, A., and Volckaert, F. A., 2005. A microsatellite linkage map of the European sea bass Dicentrarchus labrax L. Genetics, No. 170, PP: 1821–1826.

10- Dewoody, J. A., and Avise, J. C., 2000. Microsatellite variation in Marine, freshwater and anadromous fishes compare with other animal, Journal of fish biology. 56, PP: 461-473.

11- Excoffier, L., and Lischer, H. E., 2010. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular ecology resources, 10(3), PP: 564-567.

12- Fischer, W., and Bianchi, G., 1984. FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Prepared and printed with the support of the Danish International Development Agency (DANIDA). FAO, Rome. Vol, PP: 1-6. 

13- Franchini, P., Sola, L., Crosetti, D., Milana, V., Rossi, A. R., 2012. Low levels of population genetic structure in thegilthead sea bream, Sparus aurata, along the coast of Italy. ICES, J Mar Sci, 69. PP: 41–50.

14- Garcia, A. A. F., Benchimo, L. L., Barbosa, A. M. M., Geraldi, I. O., Souza, Jr. C. L., and de Souza, A. P., 2004. Comparison of RAPD, RFLP, AFLP and SSR markers for diversity studies in tropical maize inbred lines. Genetics and Molecular Biology, 27, PP: 579-588.

15- Gonzalez, E. B., Umino, T., and Nagasawa, K., 2008. Stock enhancement programme for black sea bream, Acanthopagrus schlegelii (Bleeker), in Hiroshima Bay, Japan: a review. Aquaculture research, 39(12), PP: 1307-1315.

16- Goudet, J., 1995. FSTAT (version 1.2): a computer program to calculate F-statistics. Journal of heredity, 86(6), PP: 485-486.

17- Hard, J. J., 1995. Genetic monitoring of life-history characters in salmon supplementation: problems and opportunities. American fisheries society symposium. 115, PP: 212-225.

18- Hindell, J. S., Jenkins, G. P., and Womersley, B., 2008. Habitat utilisation and movement of black bream Acanthopagrus butcheri (Sparidae) in an Australian estuary. Marine Ecology Progress, 366, PP: 219-229.

19- Jean, C. T., Lee, S. C., and Chen, C. T., 2000. Population structure of yellowfin seabream, Acanthopagrus latus, from the waters surrounding Taiwan, based on mtDNA suquences. Ichthyology Research, 47, PP: 187-192.

20- Jeong, D. S., Umino, T., Kuroda, K., Hayashi, M., Nakagawa, H., Kang, J. C., Morishima, K. E., and Arai, K., 2003. Genetic divergence and population structure of black sea bream Acanthopagrus schlegelii inferred from microsatellite analysis. Fish Science, 69, PP: 896-902.

21- Kämpf, J., and Sadrinasab, M., 2006. The circulation of the Persian Gulf: A numerical study. Ocean Science, 2, PP: 27–41.

22- Kerwath, S. E., Götz, A., Attwood, C. G., Cowley, P. D., and Sawer, W. H. H., 2007. Movement pattern and home range of Roman, Chrysoblephus laticeps. African Journal Marine Science, 29, PP: 93-103.

23- Li, J., and Ou, Y. J., 2000. Studies on the reproductive biology of the pond-cultured Sparus latus Houttuyn in the Coast of Shenzhen Bay. Journal of Zhejiang Ocean University (Natural Science), 19, PP: 139–143.

24- Lin, Y., Chen, S., Li, J., and Li, B., 2005. Assessing the genetic strature of three Japanese flounder (Paralichthys olivaceus) stock by microsatellite markers. Aquaculture, 243(1-4), PP: 103-111.

25- Liu, Z., 2007. Aquaculture Genome Technologies: First edition, Blackwell Publishing, Australia, 551p.

26- Parvez, K., and Al-Marzouk, A., 2000. First observations on natural sex reversal in a protandrous bream (Sparidentex hasta: Sparidae) from Kuwait. Pakistan Journal of Zoology, 32(3), PP: 229-244.

27- Peakall, R., and Smouse, P. E., 2006. GENALEX 6: genetic analysis in excel. Population genetic software for teaching and research. Molecular Ecology, 6, PP: 288-295.

28- Perez-Enriquez, R., and Taniguchi, N., 1999. Genetic structure of red sea bream population off Japan and southwest Pacific, using microsatellite DNA markers. Fish Science, 65, PP: 23-30.

29- Perez-Enriquez, R., Takemura, M., Tabata, K., and Taniguchi, N., 2001. Genetic diversity of red sea bream Pagrus major in western Japan in relation to stock enhancement. Fish Science,67, PP: 71-78.

30- Rousset, F., 2008. Genepop: a complete re‐implementation of the genepop software for Windows and Linux, Molecular ecology resources, 8(1), PP: 103-106.

31- Sambrook, J., and Russell, R. W., 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold spring harbor laboratory press, cold spring harbor, N.Y. PP. 1100.

32- Sanguinetti, C. J., Dias Neto, E., and Simpson, A. J. G., 1994. Rapid silver staining and recovery of PCR products separated on polyacrylamide gels. Biotechniques, 17, PP: 915–919.

33- Syazni, K. A., Satoshi, T., Kanako, U., Kenichi, O., and Tetsuya, U., 2015. Genetic structure of yellowfin black seabream Acanthopagrus latus in western Japan based on microsatellite and mtDNA marker analyses. Aquaculture Science, 63(1), PP: 17-27.

34- Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular biology and evolution, 28(10), PP: 2731-2739.

35- Van Oosterhout, C., Hutchinson, W. F., Wills, D. P. M., and Shipley, P. F., 2004. Micro-Checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes, 4, PP: 535-538.

36- Wright, S., 1978. The genetical structure of populations. Annals of Eugenics, 15 (1), PP: 323-354.

37- Xia, J. H., Huang, J. H., Gong, J. B., and Jiang, S. G., 2008. Significant population genetic structure of yellowfin seabream Acanthopagrus latus in China. Journal of Fish Biology, 73(8), PP: 1979-1992.

38- Xia, J. H., Xia, K. F., and Jiang, S. G., 2006. Characterization of 11 polymorphic microsatellite loci in the yellowfin seabream Acanthopagrus latus. Molecular Ecology Notes, 6(2), PP: 484-486.