نوع مقاله: مقاله پژوهشی

نویسندگان

دانشگاه ارومیه

چکیده

آرتمیا یکی از انواع سخت پوستان است که شوری‌های بسیار بالا را تحمل می کند. به واسطه‌ی تغییرات اقلیمی و بالا رفتن شوری منابع آب‌های داخلی و تالاب ها و همچنین اهمیت آرتمیا به عنوان یکی از فاکتورهای مهم در امر پرورش و تغذیه لارو ماهی و میگو، بررسی ویژگی‌های مولکولی جمعیت‌های مختلف آرتمیا ضروری به نظر می‌رسد. مطالعه حاضر با هدف تاثیر استرس شوری بر روی بیان ژن Na+/K+ATPase در اگزون شماره 7 دو جمعیت مختلف آرتمیا با استفاده از توسط تکنیک RT-PCR-DGGE انجام شد. در این تحقیق ابتدا 2 جمعیت از آرتمیاهای گونه Artemia franciscana و Parthenogenetic Artemia در شوری‌های 60، 120 و 180 گرم در لیتر پرورش داده شد. در انتهای دوره mRNA ژن Na+/K ATPase تهیه و پس از تولید cDNA، تصویر آن با استفاده از تکنیک DGGE بررسی و همچنین باندهای ایجاد شده توالی‌یابی شدند. نتایج این بررسی نشان داد محصول تولید شده از این ژن در A. franciscana هموزیگوت، در حالی‌که در Parthenogenetic Artemia هتروزیگوت که حاصل دو الل است. همچنین در Parthenogenetic Artemia حاصل ترجمه پروتئینی که از دو آلل مختلف حاصل شده است. جالب اینکه بر اساس نتایج این مطالعه، هیچ تفاوتی در نمونه‌های مورد بررسی در شوری‌های مختلف مشاهده نشد و ظاهراً تنها اختلاف موجود در ژنوم این جمعیت‌ها می‌باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Effect of salinity stress on the gene expression of Na/K ATPase on two Artemia populations (Artemia franciscana and Parthenogenetic Artemia) by RT-PCR-DGGE

نویسندگان [English]

  • Mehdi Mohammadzadeh
  • Kazhal Yousefi
  • Ebrahim Hoseein Najdegerami

Urmia University

چکیده [English]

Artemia is the only Crustacean that can withstand in very high salinity. Due to the climate crisis and increasing salinity of inland waters it is necessary to understand the molecular characteristics of Artemia. It can be a good way to choose the appropriate population to grow at high salinities. They are suspected of being different gene structure of Na+/ K ATPase which defer among bisexual and parthenogenetic Artemia. As a result of this molecular adaptation it seems to be seen some degrees of phenotypic adaptation which could provide difference growth abilities. In this study, two different populations of Artemia franciscana and Parthenogenetic Artemia were reared at salinities 60, 120 and 180 mg/l. At the end of the experiment the mRNA of Na+/ K ATPase was provided and converted to cDNA. Subsequent DGGE and sequencing analyses revealed that the products of these genes in A. franciscana is homozygous while in Parthenogenetic Artemia is heterozygous which is produced by two alleles. Also it was found that in the parthenogenetic Artemia protein translation and the production of two different alleles is obtained. Interestingly, no difference was observed in the samples studied. Apparently the only difference can be related to genomic variation among these populations.

کلیدواژه‌ها [English]

  • Artemia
  • salinity stress
  • sodium-potassium pump
  • RT-PCR
  • DGGE technique

اثر استرس شوری در بیان ژنNa/KATPase دردو جمعیت مختلف آرتمیا

Artemia franciscana و ArtemiaParthenogenetic با تکنیک RT-PCR-DGGE

مهدی محمد زاده1*، کژال یوسفی2 و ابراهیم حسین نجدگرامی1

ایران، ارومیه، دانشگاه ارومیه، دانشکده علوم، گروه زیست‌شناسی

تاریخ دریافت: 13/2/96           تاریخ پذیرش: 16/11/96

چکیده

آرتمیا یکی از انواع سخت‌پوستان است که شوری­های بسیار بالا را تحمل می‌کند. به‌واسطه‌ی تغییرات اقلیمی و بالا رفتن شوری منابع آب­های داخلی و تالاب‌ها و همچنین اهمیت آرتمیا به‌عنوان یکی از فاکتورهای مهم در امر پرورش و تغذیه لارو ماهی و میگو، درک مکانیسم های مولکولی فرآیندهای زیستی در جمعیت­های مختلف آرتمیا ضروری به نظر می­رسد. مطالعه حاضر باهدف تأثیر استرس شوری برروی بیان ژن Na+/K+ATPase در اگزون شماره 7 دو جمعیت مختلف آرتمیابا استفاده از تکنیک RT-PCR-DGGE انجام شد. در این تحقیق ابتدا 2 جمعیت از آرتمیاهای گونه Artemia franciscana و Artemia Parthenogenetic در شوری­های 60، 120 و 180 گرم درلیتر پرورش داده شد. در انتهای دوره mRNA ژن Na+/K ATPase تهیه و پس از تولید cDNA، تصویر آن بااستفاده از تکنیک DGGE بررسی و همچنین باندهای ایجادشده توالی­یابی شدند. نتایج این بررسی نشان داد محصول تولیدشده ازاین ژن درA. franciscana هموزیگوت، درحالی‌که درArtemia Parthenogeneticهتروزیگوت که حاصل دو آلل است. همچنین در Artemia Parthenogenetic حاصل ترجمه پروتئینی که از دو آلل مختلف حاصل‌شده است. جالب اینکه براساس نتایج این مطالعه، هیچ تفاوتی در نمونه­های موردبررسی در شوری­های مختلف مشاهده نشده و ظاهراً تنها اختلاف موجود در ژنوم این جمعیت­ها می­باشد.

واژه­های کلیدی: آرتمیا، استرس شوری، پمپ سدیم-پتاسیم، RT-PCR، تکنیک .DGGE

* نویسنده مسئول، تلفن: 04432776707 ،  پست الکترونیکی: m.mohamadzade@urmia.ac.ir

مقدمه

 

در سال­های اخیر در بیشتر نقاط جهان، صنعت آبزی‌پروری بعنوان راهی جهت دسترسی سریع به پروتئین ارزان انتخاب ‌شده است. با این‌حال از عمده مشکلات این صنعت تهیه غذای مناسب برای آبزیان از جمله ماهی و میگو می‍باشد (6، 11 ،13و 48). پرورش آرتمیا و استفاده از آن با وجود داشتن متوسط 55-52 درصد پروتئین و 15- 4 درصد چربی و برخی اسیدهای آمینه و اسید­های چرب ضروری و همچنین بدلیل داشتن برخی آنزیم­های گوارشی در بدن خود، می­تواند نقش در رونق صنعت آبزی‌پروری داشته باشد (7، 15 و 38).

در میان جانوران پر­سلولی، آرتمیا یکی از موجوداتی است که قادر به تحمل شرایط بسیار سخت محیطی ازجمله شوری­های بالا می­باشد (18 و 32). این موجود زنده دارای اندام­های تخصص‌یافته برای دفع نمک اضافی (پمپ سدیم-پتاسیم) از همولنف ایزواسموتیک داخلی به محیط خارج می­باشد (22). محل قرارگیری پمپ­های پروتئینی دفع نمک، در دوران لاروی و بلوغ دارای تفاوت­هایی می‍باشد چنانچه محل قرارگیری این پمپ­ها در دوران لاروی در غدد نمکی پشت گردن و در دوران بلوغ در بخش­های خارجی پاهای ضمایم سینه­ای، غدد ماکزیلاری و لوله گوارش میانی قراردارد (34). نتایج تحقیقات مختلف نشان داده است درنتیجه‌ی  عملکرد این پروتئین در انتقال یون­های Na+ و K+ از غشای پلاسمایی آرتمیا، فشار اسمزی داخل بدن آن همیشه در یک محدوده نرمال قرار دارد (5، 22، 24 و 34).

براساس مطالعات قبلی وجود پلی­مورفیسم مولکولی در ژن کنترل­کننده پمپ Na+/K+ ATPase در توانایی جمعیت­های متفاوت آرتمیا برای تحمل شوری­های مختلف، به اثبات رسیده است (10). براساس نتایج این مطالعات، اختلاف ژنتیکی قابل‌توجهی  در ساختار یکی از اگزون­های ژن  Na+/K+ATPaseبین تیپ­های مختلف آرتمیا ازجمله  آرتمیای دوجنسی و پارتنوژنز وجود دارد بااین­حال  محصول پروتئینی مشابه حاصل می­شود (21 و40). نظر به اختلافات فنوتیپی و قدرت سازش جمعیت­های مختلف آرتمیا برای رشد در شوری­های مختلف، به نظر می‌رسد که بایستی اختلافات ساختاری در محصول این ژن در بین جمعیت­های مختلف آرتمیا وجود داشته باشد. به‌بیان‌دیگر جهش دراین ژن بایستی موجب تغییر پیرایش (Gene splicing frame shift) در این ژنوم باشد که سبب تغییر پروتئین حاصل از این ژن می­شود. همچنین وجود جهش­های تک نوکلئوتیدی در اگزون شماره 7 می­تواند موجب تغییر ساختار پمپ سدیم-پتاسیم در بین جمعیت­های مختلف آرتمیا شود. تغییر ناحیه­ای در ساختار زیر واحد آلفا از ژن Na+/K+ATPase می­تواند احتمالاً موجب تغییر کارایی این پمپ غشایی شود (10).

در زمینۀ ژنتیک مولکولی و تکنیک­های مربوط به آن، نظرات مختلفی ارائه‌شده  است که به­واسطه آن­ها شناسایی جمعیت­های نادر ژنتیکی فراهم گردیده است. هدف اصلی بسیاری از آزمایشات ژنتیک مولکولی در آبزیان، آنالیز ساختار جمعیتی، تنوع ژنتیکی، ارتباطات گونه­ای، سیستماتیک و طبقه­بندی آن­ها می­باشد (37). در دهه­های اخیر بررسی نقش عوامل ژنتیکی در تأثیرپذیری جانداران از عوامل محیطی، اهمیت بسیار زیادی پیدا کرده است. بررسی این عوامل ژنتیکی می­تواند کمک بسیار زیادی در تعیین جمعیت­های مقاوم به تنش­های محیطی نماید. از روش­های استفاده‌شده در این بررسی‌ها  می­توان از تکنیک RT-PCR-DGGEنام برد. این روش امروزه یکی از مهم­ترین ابزار­ها در زمینۀ اکولوژی میکروبی محسوب می­شود (44 و 49). همچنین این روش در متمایز کردن سویه­های مختلف باکتریایی براساس تفاوت در توالی­هایشان از یکدیگر (1 ،16،26 و 47)، شناخت و رد­یابی جهش در بین ارگانیسم­های با ارتباط نزدیک­تر باهم و در بررسی اکوسیستم­های پیچیده مانند دریاچه، رودخانه، دریا و خاک کاربرد دارد. نمونه­‌ای‌ از استفاده‌ از روش  DGGEبرای‌ یافتن‌ پلی‌­مورفیسم‌ در اگزون‌ 10 گیرنده هورمون‌ رشد توسط‌ جی و همکاران‌ (1999) انجام‌شده است (31).

دریاچه­ی ارومیه در ایران با مساحتی بالغ‌ بر 5000 کیلومترمربع، همیشه به‌عنوان یکی از زیستگاه­های طبیعی مناسب برای آرتمیا محسوب می­شود (14). از زیستگاه‌های طبیعی دیگر تولید آرتمیا می‌توان از دریاچه­ی بزرگ نمک (Great Salt Lake) در آمریکا که بدون شک نقش حیاتی را در تأمین نیاز­های جهانی سیست آرتمیا ایفا می­کند، مثال زد (3 ، 9 و 35). البته در چند سال گذشته به­دلیل کاهش نزولات آسمانی در دریاچه ارومیه، میزان شوری آب این دریاچه افزایش چشمگیری پیداکرده  و به 350 گرم برلیتر رسیده است (4). شوری بالا باعث کاهش میزان تولید توده­ی زنده و سیست آرتمیا به میزان بسیار قابل‌توجه شده است (19 و 32). به نظر می­رسد متفاوت بودن ساختار ژن Na+/K ATPase در جمعیت­های دوجنسی و پارتنوژنز آرتمیا که ناشی از درجات مختلفی از پلی­مورفیسم مولکولی می­باشد، قادر می­باشد فنوتیپ­های مختلفی را برای رشد در شوری­های مختلف ایجاد نماید. این مسئله بررسی ویژگی جمعیت­های مختلف آرتمیا را ازنظر نحوه مقابله بااین شرایط ازنظر مولکولی، ضروری ساخته است. مطالعه حاضر باهدف  تأثیر استرس شوری بر روی بیان ژن Na+/K+ATPase با استفاده از اگزون شماره 7 توسط تکنیک RT-PCR-DGGE انجام شد.

مواد و روشها

سیست­های آرتمیای مورداستفاده  دراین بررسی از بانک سیست پژوهشکده آرتمیا دانشگاه ارومیه تهیه شدند. این سیست­ها شامل سیست­های آرتمیا فرانسیسکانا (Artemia fransiscana) و آرتمیای پارتنوژنتیک دریاچه ارومیه (Parthenogenetic Artemia) بودند. سیست­های هردو جمعیت تحت شرایط یکسان (آب دریای  ppt35  فیلتر شده با فیلتر 45/0 میکرون، دمای 25 درجه سانتی­گراد و نور و هوادهی به حد کافی) در ظروف فالکون مخروطی براساس پروتکل استاندارد تخم­گشایی گردید (20). این بررسی در 3 تیمار شوری (180،120و60 گرم در لیتر) و هر تیمار با 3 تکرار انجام شد. از هر جمعیت آرتمیا تعداد500 عدد لارو اینستار یک شمارش‌شده  و به داخل ظروف استوانه­ای مخصوص حاوی 1 لیتر (به ازای هر آرتمیا دو میلی­لیتر آب) منتقل گردید. دمای پرورش1  ±26 درجه سانتی­گراد و هوادهی  از ته ظرف مخروطی با کمک پیپت انجام شد. براساس نتایج کارهای آقای‌ کاتیو و همکاران‌ (1992) غذای‌ مورد استفاده‌ در پرورش آرتمیا‌، ترکیبی از جلبک‌ Dunaliella salina با غلظت ‌Cells/ml106×18 و مخمّر فرموله‌ شده‌ lansy Pz با غلظت‌ g1 در ml150سرم فیزیولوژیک 9% بود (25). شوری ‌ظروف‌ پرورش‌، هرروز یکبار توسط شوری­‌سنج‌ اندازه‌گیری‌ می‌­شد و در صورت‌ افزایش‌ یا کاهش شوری‌، به ترتیب با اضافه­کردن‌ آب‌ مقطّر یا آب دریا، شوری‌ آب‌ تنظیم می‌­شد. تراکم آرتمیا در روز 8 به یک آرتمیا در سه میلی‌لیتر آب و در روز 14 به یک آرتمیا در چهار میلی‌لیتر آب کاهش داده شد. در روز 17 پرورش، آرتمیا­های هر تیمار به‌طور جداگانه توسط فیلتر 400 میکرومتری جداشده و توسط آب شیر و آب مقطر استریل به‌منظور برداشت نمک و مواد اضافی کاملاً شستشو شدند و به میکرو­تیوب­های ml5/1 منتقل و در دمای °c80- نگهداری شدند تا سایر آنالیز­ها بر روی آن­ها صورت گیرد (17).

تکنیک RT-PCR-DGGE اصولاً"برای کشف تغییرات پایه­ای و شناسایی تغییرات تصادفی در ساختارDNA  و آشکار­سازی جهش­ها است. فراورده­های PCR در این روش، درصورتی‌که  دارای طول قطعات ژنومی بیشتری باشند پس از بررسی بر روی ژل آگارز تحت تأثیر آنزیم برش­دهنده قرار می­گیرند و برای‌ جلوگیری از دناتوره‌ شدن‌ کامل قطعات‌ دو رشته­ای حاصل‌ از زنجیره­پلی‌مراز، از یک‌ ناحیه‌ حاوی‌ بالاترین‌ دمای‌ ذوب‌ مصنوعی‌ به‌­نام ‌GC-clamp با 40-30 جفت­باز استفاده‌ می­‌شود (28). سپس قطعات کوچک در محدود ژنومی(bp400-100) جهت مشاهده تغییرات احتمالی بر روی ژل دناتوره­کننده پلی­آکریل­آمید با گرادیان حاصل از اوره و فورمامید در دمای ثابت (معمولاًсº 60-45) به ­مدت 12 تا 16 ساعت در 45 ولت الکتروفورز می­گردند (2 و 49). الکتروفورز  DGGEتکنیکی است که براساس اختلاف در دناتوره شدن و جدایی قطعات حاصل ازPCR  با اندازه مشابه درشیب اوره - فورمامید استوار است (12، 23، 41، و 42). دراین بررسی، برای استخراج RNA از بافت نمونه­ها، از کیت مخصوص استخراج RNA (سیناکلون، ایران) استفاده شد. مواد موردنیاز جهت فراگمنت موردنظر (اگزون شماره 7 ژن Na+/K+ATPase) شامل 8/3 میکرولیترآب دیونیزه، 8/1 میکرولیتر MgCl2 ،1 میکرولیتر بافر PCR ،8/0 میکرولیترdNTPs،2/0 میکرولیترTaq  پلی­مراز و 2/0 میکرولیتر از پرایمر­های (1) ex7 و dE-R بودند که در یک میکرو­تیوب 2 میلی­لیتری باهم مخلوط شدند و سپس به تعداد نمونه­ها در میکرو­تیوب­های کوچک مخصوص PCR تقسیم شدند. سپس آن­ها به دستگاه ترموسایکلر منتقل شدند و براساس پروتکل دمایی (10) cDNA ساخته شد. پرایمرهای مورداستفاده  در این مرحله دارای توالی نوکلئوتیدی به شرح زیر بودند:

d-ER: 5'-ccg-ggg-ccc-gcg-ggc-ccc-cgg-gcc-ggg-ccc-ggg-gaa-ttc-agc-acg-act-gca-aa-<g>-3'

ex7(1): 5'-cag-cca-aac-gta-tgg-ctt-<c>-3'

بعد از اتمام سیکل­هایPCR ، 10 میکرو­لیتر از نمونه­ها برای تأیید موفقیت PCR بر روی ژل آگارز یک درصد در بافر تریس/ بورات/EDTA (TBE) حاوی 4 میکرولیتر اتیدیوم بروماید، با استفاده از اشعه ماوراءبنفش (UV) و سیستم تصویربرداری Gel-documenatation آزمایش شدند و بقیه آن برای استفاده­های بعدی در دمایoC4 قرار داده شدند. تکنیک DGGE براساس پروتکل (39) انجام شد و شیب غلظتی مورداستفاده  در ژل دناتوره کننده، 50-10 % و ژل ­آکریل­آمید %9 تنظیم شد. نمونه­ها به مدت 14 ساعت در ولتاژ 120 ولت و در دمای oC57 الکتروفورز شدند. بعد از اتمام زمان الکتروفورز، ژل توسط اتیدیوم ­بروماید رنگ­آمیزی شد و سپس زیر اشعه UV موردبررسی  قرار گرفت (41 و49).

نتایج

نتایج الکتروفورز تکثیر قطعه موردنظر بوسیله پرایمرهای اختصاصی نشان داد که در تمامی نمونه‌های موردمطالعه ، یک قطعه حدوداً 280 جفت بازی بصورت کامل تکثیر یافته است. شکل 1 نشان‌دهنده این باند در تعدادی از نمونه‌ها در مقایسه با مارکر وزنی می‌باشد.

 

 

 

شکل 1- باندهای بدست آمده از الکتروفورز نمونه با وزن bp 280

 

 

قطعه اگزون 7 از ژن  Na+/K+ATPaseبرای تعیین توالی به شرکت موردنظر ارسال شد و تعیین توالی نوکلئوتیدی گردید. شکل 2 نشان‌دهنده توالی­های مرتب‌شده در یک نمونه از هر جمعیت می­باشد. این نتایج نشان داد که اختلافات بسیار کوچکی در ناحیه موردنظر برای اگزون مورد بحث وجود دارد، با بررسی توالی نوکلئوتیدی اگزون شماره7 متعلق به A. franciscana تعیین توالی شده در این تحقیق و ترجمه اسیدهای آمینه آن (شکل 3-الف) بررسی­ها نشان می­دهد که در محصول نهایی هیچ تغییری مشاهده نمی‌شود(شکل 3- ب)، با توجه به اینکه تنها اختلاف یافت شده در ناحیه موردبررسی  فقط در مولکول DNA یافت شد و هیچ اثری از اختلاف در محصول جهش یافت شده در این اگزون یافت نشد لذا با انجام Reverse transcriptase PCR محصول حاصل از این ژن در الکتروفورز گرادیانت ژل دناتوره­کننده موردبررسی  قرارگرفت. این بررسی نشان داد که محصول تولیدشده  از این ژن در A. franciscana هموزیگوت بوده درحالی‌که  در آرتمیای پارتنوژنتیک (parthenogenetic Artemia) هتروزیگوت و حاصل ترجمه پروتئینی با دو آلل مختلف می­باشد. جالب اینکه هیچ تفاوتی در نمونه­های مورد بررسی در شوری­های مختلف مشاهده نشد و ظاهراً تنها اختلاف موجود در جمعیت آرتمیا می­باشد (شکل 4).

بحث

نتایج مطالعات دیگران نشان داده است برخی از جمعیت‌های آرتمیا دارای مقاومت بیشتری نسبت به نوسانات شوری دارند که باعث تولید سویه­های مختلفی از آرتمیا شده است (8 ، 14، 32 و 50).

 

 

Parthenogenetic      AGCCGTCGAAACCCTTGGCTCCACCTCAACAATTTGCTCAGATAAGACCGGCACCCTCAC   60

A.franciscana        AGCCGTCGAAACCCTTGGCTCCACCTCAACAATTTGCTCAGATAAGACTGGCACCCTGAC   60

************************************************ ******** **

 

ParthenogeneticACAAAACCGTATGACAGTCGCTCACATGTGGTTCGATGGAACGATCACTGAGGCTGATAC  120

A.franciscanaTCAAAACCGTATGACAGTCGCTCACATGTGGTTCGACGGAACGATCACCGAGGCTGATAC  120

*********************************** *********** ***********

 

ParthenogeneticTACTGAAGATCAGTCAGGGGCTCAGTTTGATAAATCATCGGCTGGATGGAAAGCTCTTGT  180

A.franciscanaTACAGAAGATCAATCAGGGGCTCAGTTTGATAAATCATCTGCTGGATGGAAAGCTCTTGT  180

*** ******** ************************** ********************

 

Parthenogenetic      GAAAATTGCCGCTCTTTGCAGTCGTGCTGAATTCA   215

A.franciscana        TAAAATTGCCGCCCTTTGCAGTCGTGCTGAATTCA   215

 

شکل2- سکانس مرتب شده توسط نرم‌افزار در 2 جمعیت مختلف آرتمیا

 

 

   

 شکل 3- الف) توالی نوکلئوتیدی اگزون شماره7 متعلق به A. franciscana تعیین توالی شده در این تحقیق و ترجمه اسیدهای آمینه آن.

شکل 3- ب) بررسی جهش یافت شده در اگزون 7 ژن Na/K Atpase. این بررسی نشان می­دهد که باوجود یافته شدن جهش در این ناحیه در محصول نهایی هیچ تغییر مشاهده نمی‌شود.

 

 

شکل4 - ژل الکتروفورز DGGE در دو آرتمیای موردمطالعه  در شوری­های مختلف

 


تحمل این شرایط مدیون پمپ پروتئینی بسیار مهمی به نام Na+/K+ATPase می­باشد که ازنظر کارایی در آرتمیا منحصربه‌فرد می­باشد (34). اهمیت این پمپ در آرتمیا در تحمل محیط­هایی با فشار اسمزی بالا، در نتیجه عملکرد این پروتئین در انتقال Na+ و K+ از غشای پلاسمایی به اثبات رسیده است (22 و 24). بررسی­های برخی محققان، نشان داده است بخشی از سازگاری با تنش­های شوری می­تواند به ساختار مولکولی ژن کنترل‌کننده
 Na+/K+ ATPaseارتباط داده شود که در اغلب موجودات با ساختار متفاوتی وجود دارد (34 و 36).  نتایج بررسی این ژن و ژن­هایی مانند آن می­تواند از دو دیدگاه مهم باشد: دیدگاه اول بررسی مکانیسم و کارکرد ژنتیکی پمپ Na+/K+ATPase که ازنقطه‌نظر  افزایش دانش در حوزه علوم پایه دارای اهمیت زیادی می‌باشد و دیدگاه دوم بررسی مقاومت دو گونه مهم آرتمیا در برابر شوری و ارتباط آن با بحث‌های ژنتیکی می‌باشد که دیدگاه اخیر درنهایت  می‌تواند با بررسی‌های  بیشتر و همچنین مهندسی ژنتیک منجر به تولید آرتمیاهایی باشد که دارای اندازه مناسب برای اهداف آبزی­پروری درعین‌حال  مقاوم در برابر نوسانات محیطی باشد.

نتایج مطالعات بر روی ساختار مولکولی ژن Na+/K+ ATPase نشان داده است ژن­های کد­کننده زیر­واحد 1α از پمپ Na+/K+ATPase علائمی از وجود یک مکان پلی­مورفیک را در A. franciscana نشان داده­اند و ایزوفرم α1 این پمپ احتمالاً نقش کلیدی در سازگاری
A. franciscana به شوری بازی می­کند (30). این تغییرات می­تواند حاصل جهش­هایی در بخش­هایی از ساختار ژن کنترل‌کننده این پمپ در برخی از گونه‌های آرتمیا باشد. در توضیح توانایی جهش­ها و یا تغییرات تک نوکلئوتیدی در تغییر ساختار سه‌بعدی  و عملکرد پروتئین­ها تاکنون تحقیقات زیادی انجام‌شده  و جهش­های تک­ نوکلئوتیدی مسئول صد­ها ناهنجاری همچون بیماری داسی شکل گلبول­های انسان تشخیص داده‌شده است (33 و 46). لذا وجود چنین جهش­های تک نوکلئوتیدی در اگزون شماره 7 در آرتمیا هم می­تواند موجب تغییر ساختار پمپ Na+/K+ATPase در بین جمعیت­های مختلف آن باشدکه جایی در ساختار زیر­واحد 1α از این ژن موجب تغییر شده و احتمالاً موجب کاهش یا افزایش کارایی این پمپ می‌شود. در این تحقیق تأثیر شوری­های مختلف بر روی بیان ژن پمپNa+/K+ATPase  با استفاده از بررسی ناحیه اگزون شماره 7 توسط تکنیک RT-PCR-DGGE انجام شد.نتایج نشان داد که اختلافاتی در ناحیه موردبررسی وجود دارد که با نتایج تحقیقات قبلی همخوانی دارد و می‌تواند توجیه‌کننده  توانایی متفاوت دو جمعیت آرتمیا موردبررسی دراین تحقیق در تحمل شوری‌های  مختلف باشد.

در مرحله بعد برای بررسی بیشتر این اختلافات، با انجام Reverse transcriptase PCR محصول حاصل ازاین ژن، از طریق تکنیک PCR-DGGE موردبررسی دقیق‌تر قرارگرفت. نتایج نشان داد محصول تولیدشده از این ژن در A. franciscana هموزیگوت بوده درحالی‌که  در آرتمیای پارتنوژنز (parthenogenetic  Artemia) هتروزیگوت و حاصل ترجمه، پروتئینی از دو آلل مختلف می­باشد. نتایج PCR-DGGE توسط تعیین توالی و محاسبه فاصله ژنتیکی تنوع نوکلئوتیدی در اگزون 7 بین جمعیت­های مدنظر در این بررسی، این فرضیه را مطرح نمود که احتمالاً این اگزون دارای نقش بسیار مهمی در ساختار پمپ Na+/K+ATPase می­باشد که در طی روند تکاملی آرتمیا و تولید سویه­های دو­جنسی و پارتنوژنز نقش دارد (10). پیش‌ازاین به‌قصد جستجو مارکر­های مولکولی مناسب، به‌طور کلی 730 نمونه از 23 جمعیت آرتیما از نواحی مختلف دنیا برای پیدا نمودن اختلافات مولکولی در این ناحیه مورد مطالعه قرارگرفت (40). در این تحقیق روش Chelex برای استخراجDNA  از سیست (27) و روش SDS-کلروفرم برای استخراج DNA از افراد بالغ مورداستفاده قرارگرفت (45). اگزون شماره 7 این ژن با استفاده از آغازگر­های اختصاصی جنس آرتمیا تکثیر یافت.برش آنزیمی قطعه 280 جفت بازی بوسیله 8 آنزیم برش آندونوکلئاز نتوانست هیچ تفاوت مولکولی در این اگزون را نمایش دهد. استفاده از روش DGGE برای تفکیک محصول PCR بر روی ژل دناتوره­کننده نشان داد که این اگزون به‌شدت در بین گونه­های آرتمیا پلی­مورفیسم دارد که قبلاً توسط تکنیک RFLP شناسایی نشده بود (10).

به‌هرحال روش RT-PCR روش پیشرفته و دقیقی می­باشد که به‌عنوان  یک روشSemi quantitaive جهت ارزیابی Up regulation یک ژن موردتوجه  قرارگرفته است. با استفاده از این روش، بیان ژن در جنین­های دیاپوز
A. franciscana (43) و همچنین میزان بیان DNA متیل ترانسفراز 2 در طول تمام مراحل رشد در این‌گونه  تعیین شد (29). در تحقیقی دیگر نیز میزان بیان ژن زیر واحد آلفا پروتئین کیناز فعال شونده با AMP (AMPK) در طول رشد و در پاسخ به استرس در A. franciscana توسط این روش صورت گرفت (51).

1-      اکبری، ع.، قرنجیک، ش.، کوباز، پ.، کریمی، ا.، و صادقی، ا.،1395. بررسی تأثیر متقابل استرپتومایسس­های تولیدکننده  اکتوئین­ها و گندم در شرایط تنش شوری، مجله زیست‌فناوری  گیاهان زراعی، شماره 13، صفحات 68-57.

2-      توکلی، آ.، 1396. PCR- DGGE: روشی نوین در دنیای میکروبیولوژی، مجله بیولوژی کاربردی، دوره 7، شماره 3، صفحات 15-9.

3-      درویشی خاتونی، ج.، 1390. گزارش لیمنولوژی و پالئولیمنولوژی دریاچه ارومیه، فازIV : هیدرژئوشیمی دریاچه ارومیه، سازمان زمین‌شناسی  کشور، 80 صفحه.

4-      صالحی­پور، م. ع.، محمدی، ع.، و درویشی خاتونی، ج.، 1389. مدل‌سازی فضایی و زمانی نوسانات دریاچه ارومیه بااستفاده از داده‌های ماهواره‌ای، چهاردهمین همایش انجمن زمین‌شناسی  ایران و بیست و هشتمین گردهمائی علوم زمین، ارومیه.

5-       صیاد بورانی، م.، 1392. بررسی قابلیت تحمل به آب دریا و فعالیت آنزیم Na/K-ATPase در طی مراحل مختلف رشد (پار و اسمولت) بچه ماهیان آزاد دریای خزر، فصل‌نامه  پژوهش­های جانوری (مجله زیست‌شناسی  ایران)، جلد26، شماره 4، صفحات 424-414.

6-      عظیمی راد، م.، مشکینی، س.، احمدی­فر، ن.، و حسینی فر، ح.، 1395. بررسی اثرات تغذیه با آرتمیای غنی‌شده  با سین بیوتیک بر شاخص­های رشد جمعیت میکروبی روده و مقاومت در برابر استرس ماهی آنجل، نشریه شیلات، شماره 69، صفحات 78-77.

7-      کاظمی، ا.، آق، ن.، و مشکینی، س.، 1392. بررسی جایگزینی روغن‌های  گیاهی به‌جای  روغن ماهی برای غنی‌سازی  ناپلی Artemia urmiana و اثرات آن بر بازماندگی و رشد لارو ماهی قزل‌آلای  رنگین‌کمان (Oncorhynchus mykiss)، فصل‌نامه  پژوهش­های جانوری (مجله زیست‌شناسی  ایران)، جلد26، شماره 3، صفحات 266-255.

8-      لطفی، و.، آق. ن.، و سپهری. ح.،1382. اثرات شوری­های مختلف بر درصد ماندگاری، میزان رشد، طول عمر و صفات تولیدمثلی سه جمعیت از آرتمیاهای ایران، مجله علوم دانشگاه تهران، جلد 29، شماره 2، صفحات 316-305.

9-      محمدی، ع.، لک، ر.، و درویشی خاتونی، ج.، 1389. بررسی تاریخچه رسوبگذاری هولوسن دریاچه ارومیه بر اساس مغزه‌های  رسوبی تهیه‌شده  از غرب دریاچه (جنوب بزرگراه شهید کلانتری)، چهاردهمین همایش انجمن زمین‌شناسی  ایران و بیست و هشتمین گردهمائی علوم زمین، دانشگاه ارومیه.

10-   موسوی تومتری، گ.، مناف فر، ر.، و زارع، ص.،1393. کاربرد تکنیک DGGE جهت بررسی تنوع ژن Na+/K+ ATPase در بین جمعیت­های مختلف آرتمیا، فصل‌نامه  علمی- پژوهشی ژنتیک نوین، جلد 9، شماره 4، صفحات 418-411.

11-   نجد گرامی، ا. ح.، عسگری، ث.، زارع، ص.، و مناف فر، ر.، 1395. تأثیر مخمر غنی‌شده  با نانو ذرات اکسید مس بر پارامتر­های رشد، فعالیت آنزیم­های گوارشی و متابولیسم چربی در آرتمیا ارومیانا  (Artemia urmiana) و آرتمیا فرانسیسکانا (Artemia franciscana)، فصل‌نامه  پژوهش­های جانوری (مجله زیست‌شناسی  ایران)، جلد29، شماره3، صفحات 379-369.

 

12-   Turaki, A., Bömer, M., Silva, G., and Kumar, P. L., 2017. PCR-DGGE Analysis: Unravelling Complex Mixtures of Badnavirus Sequences Present in Yam Germplasm, Viruses, 9(7), 181 PP: 1-24.

13-   Agh, N., Sorgeloos, P., Abatzopoulos, T., Razavi, R. S. M., and  Lotfi, V.G., 2001. Artemia resources in Iran. International Workshop on Artemia, Urmia University, 12-15 May 2001, Urmia, Iran.

14-   Agh, N., Van Stappen, G., Bossier, P., Sepehri, H., Lotfi, V., Razavi Rouhani, S. M., and  Sorgeloos, P., 2008. Effects of Salinity on Survival, Growth, Reproductive and Life Span Characteristics of Artemia Populations from Urmia Lake and Neighboring Lagoons, Pakistan Journal of Biological Sciences, 11 (2), PP: 164-172.

15-   Ahmadi, M. R., Leibovitz, H., and Simpson, K. L., 1990. Nutrient composition of the Iranian brine shrimp (Artemia uromiana). Comparative  Biochemistry and Physiology, 95(2) , PP: 225-228.

16-   Alebouyeh, M., 2010.Molecular methods in microbial typing and identification, First ed, Iran: sarcheshme andishe tabligh, PP: 145-147.

17-   Boone, E., and Baas-Becking, L. G. M., 1931. Salt effects on eggs and nauplii of Artemia salina L, Journal of General physiology, 14(6), PP: 753-763.

18-   Browne, R., 1992. Population genetics and ecology of Artemia: Insights into parthenogenetic reproduction. Elsevier Science Publishers Ltd. Trends in Ecology and Evolution, 7, PP: 232-237.

19-   Chen, D. F., Lin, C., Wang, H. L., Zhang, L., Dai, L., Jia, S. N., Zhou, R., Li, R., Yang, J. S., Yang, F., S., Clegg, J., Nagasawa, H., and Yang, W. J., 2016. An La-related protein controls cell cycle arrest by nuclear retrograde transport of tRNAs during diapause formation in ArtemiaBmc Biology, 14: 16 PP: 1-13.

20-   Citarasu, T., Sivaram, V., Immanuel, G., Namita, R. N., and Murugan, V., 2006. Influence of selected Indian immune-stimulant herbs against white spot syndrome virus (WSSV) infection in black tiger shrimp, Penaeus monodon with reference to haematological, biochemical and immunological changes, Fish Shell fish Immunol, 21, PP: 372-384.

21-   Comeche, A., Martín-Villamil, M., Pico, Y., and Varó, I., 2017. Effect of methylparaben in Artemia franciscana,Comp Biochem Physiol C Toxicol Pharmacol, 199, PP:98-105.

22-   Conte, F. P., 1984. Structure and function of the crustacean larval salt gland, International Review of Cytology, 91, PP: 45-106.

23-   Cornelissen, J. B., de Bree, F. M., van der Wal, F. J., Kooi, E. A., Koene, M. G., Bossers , A., Smid, B., Antonis, A. F., and Wisselink, H. J., 2017. Mycoplasma detection by triplex real-time PCR in bronchoalveolar lavage fluid from bovine respiratory disease complex cases, BMC Veterinary Research, 8;13(1):97, PP: 1-12.

24-   Cortas, N., Arnaout, M., Salon, J., and Edelman, I. S., 1989. Isoforms of Na/K-ATPase in Artemia salina: Tissue distribution and kinetic characterization.J. Membrane Biology, 108, PP:187–195.

25-   Coutteau, P., Brendonck, L., Lavens, P., and Sorgeloos, P., 1992. The use ofmanipulated baker's yeast as an algal substitute for the laboratory culture of Anostraca.Hydrobiologia, 234, PP: 25–32.

26-   Dooms, S., Papakostas, S., Hoffman, S., Delbare, D., Dierckens, K., Triantafyllidis, A., Wolf, T. D., Vadstein, O. J., Abatzopoulos, T., Sorgeloos, P., and Bossier, P., 2007.  Denaturing Gradient Gel Electrophoresis (DGGE) as a tool for the characterisation of Brachionus sp, Strains,Aquaculture, 262, PP: 29–40.

27-   Estoup, A., Largiader, C. R., Perrot, E., and Chourrout, D.,1996. Rapid one -tube DNA extraction for reliable PCR detection of fish polymorphic markers and transgenes,  Molecular Marine Biology and Biotechnology, 5, PP: 295-298.

28-   Faruk Umar, A., Tahir, F.,  and Bede Agbo, E., 2017. Polymerase Chain Reaction-Denaturing Gradient Gel Electrophoresis (PCR-DGGE) Profile of Bacterial Community from Agricultural Soils in Bauchi, North-East Nigeria, Advances in Microbiology, 7, PP: 480-486.

29-   Feng, C. Z., Zhu, X. J., Dai, Z. M., Liu, F. Q., Xiang, J. H., and Yang, W. J., 2007. Identification of a novel DNA methyltransferase 2 from the brine shrimp, Artemia franciscana, Comparative biochemistry and physiology Part B, Biochemistry & molecular biology, 147, PP: 191-198.

30-   García-Sáez, A., Esclante, R., and Sastre, L., 2000. High DNA Sequence Variability at the α1 Na/K-ATPase Locus of Artemia franciscana (Brine Shrimp): Polymorphism in a Gene for Salt-Resistance in a salt-Resistant Organism, Molecular Biology and Evolution, 17(2), PP: 235-250.

31-   Ge, W., Davis, M. E., Hines, H. C., and Irvin, K. M., 2000. Rapid communication: Single nucleotide polymorphisms detected in exon 10 of the bovine growth hormone receptor gene, J ANIM SCI, 78, PP:2229-2230.

32-   HangXiao, Z., QiBin, L., Jing, S., Fei, L., Gang, W., Jun, Y., and WeiWei, W., 2013. Mitochondrial genome sequences of Artemia tibetiana and Artemia urmiana: assessing molecular changes for high plateau adaptation, Science China Life Science, 5, PP: 440–452.

33-   Hoj, S., Fredholm, M., Larsen, N. J., and  Nielsen, V. H., 1993. Growth hormone gene polymorphism associated with selection for milk fat production in lines of cattle, Animal. Genetics , 24, PP: 91-96.

34-   Holliday, C. W., Roye, D. B., and Roer ,R. D., 1990. Salinity-induced changes in branchial Na+/K+-ATPase activity and transepithelial potential difference in the brine shrimp Artemia salinaJournal of Experimental Biology ,151, PP:279-296. 

35-   Kelts, K., and Shahrabi, M., 1986. Holocene sedimentology of hypersaline Lake urmia, Nortwestern Iran, Palaeogeography, Palaeoclimatology, Palaeoecology, 54, PP: 105-130.

36-   Lind, U. 1., Alm Rosenblad, M., Wrange, A. L., Sundell, K. S., Jonsson, P. R., André , C., Havenhand, J., and Blomberg, A., 2013. Molecular characterization of the a-subunit of Na+/K+ ATPase from the euryhaline barnacle Balanus improvisus reveals multiple genes and differential expression of alternative splice variants , PLoS One, 8(10),:e77069.

37-   Lu, C. C., 1998. Diversity of cephalopoda from the waters around Taiwan, Phuket Marine Biological Center Special Publication, 18, PP:331-340.

38-   MacDonald, G. H., 1980. The use of Artemia cysts as food by the flamingo (Phoenicopterus ruber roseus) and the shelduck (Tadorna tadorna). In: The Brine Shrimp Artemia, Vol. 3 Ecology, Culturing, Use in Aquaculture (Eds G. Persoone, P. Sorgeloos, O. Roels & E. Jaspers), Universa Press, Belgium, PP: 97–104.

39-   Manaffar, R., 2012. Genetic diversity of Artemia populations in Lake Urmia, Iran. PhD thesis, Ghent University, Belgium,  160 p.

40-   Manaffar, R., Zare ,S., Agh, N., Abdolahzadeh, N., Soltanian, S., Sorgeloos, P., Bossier, P.,  and Van Stappen, G., 2011. SNP detection in Na/K ATPase gene a1 subunit of bisexual and parthenogenetic Artemia  strains by RFLP screening, Journal of Molecular Ecology Recourse, 11, PP: 211-214.

41-   Myers, R. M., Maniatis, T., and Lerman, L. S., 1987. Detection and localization of single base changes by denaturing gradient gel electrophoresis,Methods Enzymol, 155, PP:501–527.

42-   Bhakta, N. J., Lahiri, S., , Bhuiyna, A. F., Rokunuzzaaman, M., Ohonishi, K., Iwasaki, K., and Jana, B. B., 2017. Profiling of heavy metal(loid)-resistant bacterial community structure by metagenomic-DNA fingerprinting using PCR – DGGE for monitoring and bioremediation of contaminated environment, Energy, Ecology and Environment,2, PP:1-8.

43-   Qiu, Z., Tsoi , S. C.M., and MacRae, T. H., 2007. Gene expression in diapause-destined embryos of the crustacean, Artemia franciscana, Mech Develop, 124, PP: 856–867.

44-   Rychlik, T., Szwengiel, A., Bednarek, M., Arcuri, E., Montet, E., Mayo, B., Nowak, J., and Czarnecki, Z., 2017. Application of the PCR-DGGE technique to the fungal community of traditional Wielkopolska fried ripened curd cheese to determine its PGI authenticity, Food Control ,73, PP: 1074-1081.

45-   Sambrook, J., Fritsch, E. F., and Maniatis, T., 1989. Molecular Cloning - A Laboratory Manual. 2nd Edition. Cold Spring Harbor Press, Cold Spring Harbor, New York, PP: 260-280.

46-   Sasabe, T., Furukawa, A., Matsushita, S., Higuchib, S., and Ishiuraa, S., 2007. Association analysis of the dopamine receptor D2 (DRD2) SNP rs1076560 in alcoholic patients, Neuroscience Letters, 412, PP:139-142.

47-   Sheu, S. J., Chen, H. C., Lin, C. K., Lin, W. H., Chiang, Y. C., Hwang, W. Z., and Tsen, H. Y., 2013. Development and application of tuf gene-based PCR and PCR-DGGE methods for the detection of 16 Bifidobacterium species, Journal of Food and Drug Analysis, 21, PP: 177-183.

48-   Sorgeloos, P., Dhert, P., and Can dreva, P., 2001. Use of the shrimp, Artemia SPP, in marine fish larviculture, Aquaculture ,200 , PP: 147-159.

49-   Vanhoutte, T., Huys, G., and Cranenbrouck, S., 2005. Exploring microbial ecosystems with denaturing gradient gel electrophoresis (DGGE), BCCM NEWS, PP: 2-4.

50-   Yik Sung, Y., Pineda, C. H., Macrae, T. h., Sorgeloos, P., and Bossier, P., 2008. Expoosure of gnotobiotic Artemia franciscana larvae to abiotic stress promotes heat shock protein 70 synthesis and enhances resisance to pathogenic Vibrio campbelii, Cell Stress and Chaperones,13, PP:59-66.

51-   Zhu, X. J., Feng, C. Z., Dai, Z. M., Zhang, R. C., and Yang, W. J., 2007. AMPK alpha subunit gene characterization in Artemia and expression during development and in response to stress, Stress, 10, PP:53–63.